ID: 1116034778

View in Genome Browser
Species Human (GRCh38)
Location 14:39614555-39614577
Sequence CCAGGACAACACTTCTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116034778_1116034781 4 Left 1116034778 14:39614555-39614577 CCAAAATAGAAGTGTTGTCCTGG No data
Right 1116034781 14:39614582-39614604 ATTTTAAAAACACACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116034778 Original CRISPR CCAGGACAACACTTCTATTT TGG (reversed) Intergenic
No off target data available for this crispr