ID: 1116035189

View in Genome Browser
Species Human (GRCh38)
Location 14:39618935-39618957
Sequence AAAAAGAAGCAAAATGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116035189_1116035191 -7 Left 1116035189 14:39618935-39618957 CCGACCTCATTTTGCTTCTTTTT No data
Right 1116035191 14:39618951-39618973 TCTTTTTAACTGTATATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116035189 Original CRISPR AAAAAGAAGCAAAATGAGGT CGG (reversed) Intergenic
No off target data available for this crispr