ID: 1116035544 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:39622798-39622820 |
Sequence | TGTCCTTGGCAGGACATGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1116035544_1116035551 | 17 | Left | 1116035544 | 14:39622798-39622820 | CCATCCATGTCCTGCCAAGGACA | No data | ||
Right | 1116035551 | 14:39622838-39622860 | TATGGCTGCATAATATTCCATGG | 0: 599 1: 25465 2: 13987 3: 8082 4: 5376 |
||||
1116035544_1116035548 | -1 | Left | 1116035544 | 14:39622798-39622820 | CCATCCATGTCCTGCCAAGGACA | No data | ||
Right | 1116035548 | 14:39622820-39622842 | ATGACCTTGTTCCTTTTTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1116035544 | Original CRISPR | TGTCCTTGGCAGGACATGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |