ID: 1116035544

View in Genome Browser
Species Human (GRCh38)
Location 14:39622798-39622820
Sequence TGTCCTTGGCAGGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116035544_1116035551 17 Left 1116035544 14:39622798-39622820 CCATCCATGTCCTGCCAAGGACA No data
Right 1116035551 14:39622838-39622860 TATGGCTGCATAATATTCCATGG 0: 599
1: 25465
2: 13987
3: 8082
4: 5376
1116035544_1116035548 -1 Left 1116035544 14:39622798-39622820 CCATCCATGTCCTGCCAAGGACA No data
Right 1116035548 14:39622820-39622842 ATGACCTTGTTCCTTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116035544 Original CRISPR TGTCCTTGGCAGGACATGGA TGG (reversed) Intergenic
No off target data available for this crispr