ID: 1116044164

View in Genome Browser
Species Human (GRCh38)
Location 14:39722411-39722433
Sequence CAATAAGCACTGCATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116044164_1116044168 -8 Left 1116044164 14:39722411-39722433 CCTTGCCCATGCAGTGCTTATTG No data
Right 1116044168 14:39722426-39722448 GCTTATTGCTTTCTTTGGCTTGG No data
1116044164_1116044169 -7 Left 1116044164 14:39722411-39722433 CCTTGCCCATGCAGTGCTTATTG No data
Right 1116044169 14:39722427-39722449 CTTATTGCTTTCTTTGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116044164 Original CRISPR CAATAAGCACTGCATGGGCA AGG (reversed) Intergenic
No off target data available for this crispr