ID: 1116044164 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:39722411-39722433 |
Sequence | CAATAAGCACTGCATGGGCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1116044164_1116044168 | -8 | Left | 1116044164 | 14:39722411-39722433 | CCTTGCCCATGCAGTGCTTATTG | No data | ||
Right | 1116044168 | 14:39722426-39722448 | GCTTATTGCTTTCTTTGGCTTGG | No data | ||||
1116044164_1116044169 | -7 | Left | 1116044164 | 14:39722411-39722433 | CCTTGCCCATGCAGTGCTTATTG | No data | ||
Right | 1116044169 | 14:39722427-39722449 | CTTATTGCTTTCTTTGGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1116044164 | Original CRISPR | CAATAAGCACTGCATGGGCA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |