ID: 1116044169

View in Genome Browser
Species Human (GRCh38)
Location 14:39722427-39722449
Sequence CTTATTGCTTTCTTTGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116044163_1116044169 2 Left 1116044163 14:39722402-39722424 CCTGATTCTCCTTGCCCATGCAG No data
Right 1116044169 14:39722427-39722449 CTTATTGCTTTCTTTGGCTTGGG No data
1116044162_1116044169 6 Left 1116044162 14:39722398-39722420 CCTTCCTGATTCTCCTTGCCCAT No data
Right 1116044169 14:39722427-39722449 CTTATTGCTTTCTTTGGCTTGGG No data
1116044164_1116044169 -7 Left 1116044164 14:39722411-39722433 CCTTGCCCATGCAGTGCTTATTG No data
Right 1116044169 14:39722427-39722449 CTTATTGCTTTCTTTGGCTTGGG No data
1116044161_1116044169 7 Left 1116044161 14:39722397-39722419 CCCTTCCTGATTCTCCTTGCCCA No data
Right 1116044169 14:39722427-39722449 CTTATTGCTTTCTTTGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116044169 Original CRISPR CTTATTGCTTTCTTTGGCTT GGG Intergenic
No off target data available for this crispr