ID: 1116045403

View in Genome Browser
Species Human (GRCh38)
Location 14:39736744-39736766
Sequence TGCTATCTTAAAATAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116045403_1116045405 -9 Left 1116045403 14:39736744-39736766 CCAACTTTTATTTTAAGATAGCA No data
Right 1116045405 14:39736758-39736780 AAGATAGCAGCGTTAGTGTAGGG No data
1116045403_1116045406 -8 Left 1116045403 14:39736744-39736766 CCAACTTTTATTTTAAGATAGCA No data
Right 1116045406 14:39736759-39736781 AGATAGCAGCGTTAGTGTAGGGG No data
1116045403_1116045409 20 Left 1116045403 14:39736744-39736766 CCAACTTTTATTTTAAGATAGCA No data
Right 1116045409 14:39736787-39736809 AAAGAGAATGAGATTGAATTGGG No data
1116045403_1116045408 19 Left 1116045403 14:39736744-39736766 CCAACTTTTATTTTAAGATAGCA No data
Right 1116045408 14:39736786-39736808 AAAAGAGAATGAGATTGAATTGG No data
1116045403_1116045404 -10 Left 1116045403 14:39736744-39736766 CCAACTTTTATTTTAAGATAGCA No data
Right 1116045404 14:39736757-39736779 TAAGATAGCAGCGTTAGTGTAGG No data
1116045403_1116045407 -7 Left 1116045403 14:39736744-39736766 CCAACTTTTATTTTAAGATAGCA No data
Right 1116045407 14:39736760-39736782 GATAGCAGCGTTAGTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116045403 Original CRISPR TGCTATCTTAAAATAAAAGT TGG (reversed) Intergenic
No off target data available for this crispr