ID: 1116050198

View in Genome Browser
Species Human (GRCh38)
Location 14:39793384-39793406
Sequence TAGAATAATCAGGAGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116050198_1116050201 1 Left 1116050198 14:39793384-39793406 CCGTTCTCCTCCTGATTATTCTA No data
Right 1116050201 14:39793408-39793430 AACCACTAATTCATTCTTGTAGG No data
1116050198_1116050203 28 Left 1116050198 14:39793384-39793406 CCGTTCTCCTCCTGATTATTCTA No data
Right 1116050203 14:39793435-39793457 AATTTCATTATCTCATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116050198 Original CRISPR TAGAATAATCAGGAGGAGAA CGG (reversed) Intergenic
No off target data available for this crispr