ID: 1116055946

View in Genome Browser
Species Human (GRCh38)
Location 14:39863946-39863968
Sequence TTATGTGGTTCCTAAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116055937_1116055946 25 Left 1116055937 14:39863898-39863920 CCACCTCAGGTAGGTTACTTCTC No data
Right 1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG No data
1116055942_1116055946 -4 Left 1116055942 14:39863927-39863949 CCAGTCCGGATTCTAAATCTTAT No data
Right 1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG No data
1116055941_1116055946 -3 Left 1116055941 14:39863926-39863948 CCCAGTCCGGATTCTAAATCTTA No data
Right 1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG No data
1116055944_1116055946 -9 Left 1116055944 14:39863932-39863954 CCGGATTCTAAATCTTATGTGGT No data
Right 1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG No data
1116055938_1116055946 22 Left 1116055938 14:39863901-39863923 CCTCAGGTAGGTTACTTCTCCTT No data
Right 1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG No data
1116055940_1116055946 3 Left 1116055940 14:39863920-39863942 CCTTGACCCAGTCCGGATTCTAA No data
Right 1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116055946 Original CRISPR TTATGTGGTTCCTAAAAAGG TGG Intergenic
No off target data available for this crispr