ID: 1116058660

View in Genome Browser
Species Human (GRCh38)
Location 14:39895029-39895051
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 118, 1: 138, 2: 123, 3: 118, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116058660_1116058664 8 Left 1116058660 14:39895029-39895051 CCTGCATCTTTGAAGAGCCCTGT 0: 118
1: 138
2: 123
3: 118
4: 251
Right 1116058664 14:39895060-39895082 TTCTCTGTATGTTGGATCTAAGG No data
1116058660_1116058665 11 Left 1116058660 14:39895029-39895051 CCTGCATCTTTGAAGAGCCCTGT 0: 118
1: 138
2: 123
3: 118
4: 251
Right 1116058665 14:39895063-39895085 TCTGTATGTTGGATCTAAGGTGG No data
1116058660_1116058666 12 Left 1116058660 14:39895029-39895051 CCTGCATCTTTGAAGAGCCCTGT 0: 118
1: 138
2: 123
3: 118
4: 251
Right 1116058666 14:39895064-39895086 CTGTATGTTGGATCTAAGGTGGG No data
1116058660_1116058663 0 Left 1116058660 14:39895029-39895051 CCTGCATCTTTGAAGAGCCCTGT 0: 118
1: 138
2: 123
3: 118
4: 251
Right 1116058663 14:39895052-39895074 AATTGCTCTTCTCTGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116058660 Original CRISPR ACAGGGCTCTTCAAAGATGC AGG (reversed) Intergenic
900118255 1:1037705-1037727 ACATGGCCCCTCATAGATGCAGG - Intronic
900211191 1:1456611-1456633 AGAGGGGTCTTCACAGCTGCAGG + Intronic
900217016 1:1486930-1486952 AGAGGGGTCTTCACAGCTGCAGG + Intronic
901444266 1:9297922-9297944 ACGGAGCTCTTCAGGGATGCTGG - Intronic
901904318 1:12394570-12394592 ACAGGGCTCTTCAAAGATGCAGG + Intronic
903790602 1:25890364-25890386 AGAGGGCTCTGCAAAGCTCCAGG + Intronic
904059669 1:27698725-27698747 ACTGAGCTACTCAAAGATGCTGG + Intergenic
904180013 1:28659635-28659657 ACAGAGCTCTTCAAGGACACGGG + Intergenic
904254424 1:29245530-29245552 ACAGGGCTGTGCAAGGAGGCTGG - Intronic
904992247 1:34602455-34602477 ACAGAGCTCTTCAAGGATTCTGG + Intergenic
905353817 1:37366890-37366912 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
905464962 1:38146205-38146227 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
906867833 1:49441620-49441642 ATAGGGCTCTTCAAAGATGCAGG - Intronic
906879436 1:49574578-49574600 ACAGGGCTCTTTAAAAATGCAGG - Intronic
907597094 1:55730192-55730214 ACAGGGGTCTTCAAAGATGCAGG - Intergenic
907780089 1:57558943-57558965 ACAGGGCTCTTCAAAGATCCAGG - Intronic
908616491 1:65928611-65928633 ACAGGGCTCTTCAAAGATGCAGG + Intronic
908737313 1:67290201-67290223 ACAGGACTCTTCAAAGATGCAGG - Intergenic
909172849 1:72317354-72317376 ACAGGGCTCTGTAAAGATACAGG + Intergenic
909810754 1:79929666-79929688 ACGGGGCTCTTCAAAGACGCAGG - Intergenic
910587957 1:88899841-88899863 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
910639222 1:89441859-89441881 ATGAGGCTCTACAAAGATGCAGG + Intergenic
910790167 1:91042530-91042552 ACAGGGCTCTTCAAAGATACAGG - Intergenic
910831404 1:91465605-91465627 ACAGGGTCCTTCAAAGATGCAGG + Intergenic
910948176 1:92616267-92616289 ACAGGCCTCTTCAAAGATGCAGG - Intronic
911109361 1:94166102-94166124 ACAGGGCTCTTCAAAGATGCAGG + Intronic
911456663 1:98133029-98133051 ACAAGGCTCTTCACAGACCCAGG + Intergenic
911883326 1:103268583-103268605 ACAGGGCTCTTCAGAGATGCAGG - Intergenic
911980213 1:104557769-104557791 ACAGGGCTTCTCAATGATGCAGG - Intergenic
911982137 1:104581169-104581191 ACAGGGCTCGTCAAAAATGCAGG + Intergenic
912050919 1:105526839-105526861 ATAGGGCTCTTCAAAGGTACAGG + Intergenic
912066797 1:105755055-105755077 ACAGGGCTCCACAAAGATGCAGG - Intergenic
912733574 1:112130721-112130743 ACAGGGCTCTTGAAAGATGCAGG + Intergenic
912944067 1:114070069-114070091 ACAGGGCTCTTCAAAGATCCAGG + Intergenic
915599448 1:156913328-156913350 ACAGGGCTTTCCAGAGAAGCTGG - Intronic
915667920 1:157461546-157461568 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
916106589 1:161437186-161437208 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
916329649 1:163600329-163600351 ACAGAGCTCTTCAAGAATACTGG - Intergenic
917052715 1:170941738-170941760 ACAGAGCTCCTCAAGGATGGTGG + Intronic
917217467 1:172692801-172692823 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
917462473 1:175244324-175244346 ATAGGGCTCTTCAAAGATGCAGG - Intergenic
917807415 1:178626084-178626106 ACTGGGCTTTTCAAAGAAGTGGG - Intergenic
918065868 1:181101312-181101334 AGAGGGCTGTTCAATAATGCAGG + Intergenic
918558915 1:185840630-185840652 ACTTGGCTCTTCTCAGATGCTGG + Intronic
918755968 1:188339685-188339707 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
918774264 1:188608864-188608886 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
918814851 1:189169361-189169383 ACAGAGCTCTTCAAGAATGCAGG - Intergenic
918958017 1:191236134-191236156 ACAAGCCTCTTCGAAGATGTAGG - Intergenic
919241555 1:194922613-194922635 ACAGTGCTCTTCAAAGATGCAGG - Intergenic
920272842 1:204779563-204779585 ACAGAACTTTTCAAAGATGCTGG + Intergenic
920699211 1:208204990-208205012 GCAGGGCTCCTCACAGAAGCTGG - Intronic
921252126 1:213307978-213308000 ACAGGGCTGTTCAATGATACTGG + Intergenic
921848988 1:219914050-219914072 ACAGGGTTTTTCAGAGGTGCTGG - Intronic
922847358 1:228697661-228697683 ACAGAGCTCTTCAAGGTTGTGGG - Intergenic
922877815 1:228954211-228954233 ACAGGCCACTTCCAAGATGGTGG - Intergenic
922950550 1:229555326-229555348 GAAGGACTCTTAAAAGATGCAGG - Intronic
923253827 1:232201277-232201299 ACAGGGCTCGTGAAAGATGCAGG + Intergenic
924037327 1:239950509-239950531 ACAGGGCTCTTCAAAGACGCTGG + Intergenic
924451410 1:244182195-244182217 ACAGGGGTCTGCAGAGTTGCTGG - Intergenic
924840998 1:247709449-247709471 ACAGAGCTCTTCAAAGATGCAGG + Intergenic
924847398 1:247787127-247787149 ACAAGGCTCTTCAAAGATGCAGG + Intergenic
1064517902 10:16170129-16170151 ACAGGGCTGTTCAAAGATTCAGG + Intergenic
1064545900 10:16449697-16449719 ACAGAGCTCTTCAAGGATGCAGG + Intronic
1065606750 10:27426144-27426166 ACAGAGATCTTCAAGGATGCTGG - Intergenic
1066167286 10:32801148-32801170 ACAGAGCTCTTCAAGGATGCAGG + Intronic
1066957554 10:42187507-42187529 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1067125847 10:43514781-43514803 AGAGGGCTCTTCAAAGATGCAGG + Intergenic
1067332898 10:45338326-45338348 ACGGGGCTCTTCAAAGATGCAGG - Intergenic
1067754605 10:48995613-48995635 ACGGGGCTCTTCAAACATGCAGG + Intergenic
1067989485 10:51194777-51194799 AGAAGGCTCTTGCAAGATGCTGG - Intronic
1068225598 10:54103496-54103518 ATAGGGCTCTTCAAAGATGCAGG + Intronic
1068446961 10:57136694-57136716 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1068837496 10:61570496-61570518 ACACGGTTCTTCAAAGATGCAGG + Intergenic
1069140054 10:64811222-64811244 CCAGAGTTCTTCAAAGATCCTGG + Intergenic
1069791114 10:71021634-71021656 ATAGGGCTCTTCAAAGATGCAGG + Intergenic
1070933556 10:80277086-80277108 ACAGGGCTCTTCCAAGAAGAAGG + Intronic
1071875009 10:89836081-89836103 ACCTGGCTCTTCATACATGCTGG + Intergenic
1071943032 10:90609673-90609695 ACAGGGCTTCTCAAAGATGCAGG + Intergenic
1072209517 10:93233582-93233604 ATAGGGCTCTTCAAACATGTAGG + Intergenic
1072360223 10:94652256-94652278 ACAGGGCTCTTCAAAGAGGCAGG - Intergenic
1072362176 10:94670337-94670359 ACAGAGTTCTTCAAGGATGCTGG + Intergenic
1072606355 10:96986380-96986402 TGTGGGCTCTTCACAGATGCTGG - Intergenic
1073557086 10:104464010-104464032 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1073584815 10:104699640-104699662 ACCCGGCTCTTCAAAAAAGCTGG - Intronic
1073656901 10:105426133-105426155 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1074244694 10:111676971-111676993 ACAGATCTCTTCAAGGATTCAGG - Intergenic
1074712277 10:116187323-116187345 ACAGGGTCCTGCAGAGATGCTGG - Intronic
1075103011 10:119519223-119519245 ACAGGGCTCTTACAAGGTGAGGG - Intronic
1076006258 10:126950014-126950036 AGATGGCTCCTCAAAGACGCAGG - Intronic
1076874081 10:133207510-133207532 CCAGGGCTCTGCAAAGCTGCCGG - Intronic
1076927664 10:133501124-133501146 GCAAGGCTCTTCAAAGATTCAGG + Intergenic
1081065710 11:38536793-38536815 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1081072542 11:38629189-38629211 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1081110214 11:39126487-39126509 ACAGGGCTCTTCAAAGATACAGG - Intergenic
1081549951 11:44101653-44101675 ACTGAGCTTCTCAAAGATGCAGG - Intronic
1081560075 11:44205576-44205598 ACAGGCCTCTTCCAAGACCCTGG + Intronic
1081608788 11:44545941-44545963 ACAGGGCTCTCCAGAGATGCAGG - Intergenic
1082671448 11:56041143-56041165 ACAGGGCTCTTCAAAGATGTAGG - Intergenic
1082999369 11:59277629-59277651 ACAGGGCCTTTCAAAGATGCAGG - Intergenic
1084430650 11:69109015-69109037 AGCCGGCTCTTCACAGATGCTGG - Intergenic
1085010910 11:73141497-73141519 ACAAGGCTCTGCAAAGCTGCAGG + Intronic
1085685705 11:78620275-78620297 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1085747322 11:79126329-79126351 ACAGGGCTCTTTAAAGATGCAGG - Intronic
1086197857 11:84162982-84163004 ATAGAGCTCTGCAAATATGCTGG - Intronic
1086278376 11:85158553-85158575 ACAGGGCCCTTCAAAGATGCAGG - Intronic
1086833872 11:91598495-91598517 ACAGAGCTCTTCAAAGATGCAGG - Intergenic
1087373810 11:97318848-97318870 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1087410995 11:97790062-97790084 ACAGGGCTCTTCAAAGATGTAGG + Intergenic
1088191929 11:107236413-107236435 ATAGGGCTCTTCAAAGATGCAGG + Intergenic
1088214395 11:107491920-107491942 ACAGAGCTCTTCAGGGATGCTGG + Intergenic
1088264900 11:107979639-107979661 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1088407864 11:109500576-109500598 ATAGGGCTCTTCAAAGATGCAGG + Intergenic
1088565642 11:111169820-111169842 TCAGGACTCTTGAAAGATGGAGG - Intergenic
1089870198 11:121665685-121665707 AGAGGGCAGTTCAGAGATGCTGG + Intergenic
1089903374 11:122011716-122011738 ACAGAGCTCTTCAAAGATGCAGG - Intergenic
1090209920 11:124911685-124911707 ACAGAGCTCTTCAAAGATATAGG + Intergenic
1090221864 11:125033503-125033525 ACAGAGCTCTTCAAAGATGTAGG + Intronic
1091051485 11:132376832-132376854 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1091103364 11:132896318-132896340 ACAGAGCTCTTCAGGGGTGCTGG - Intronic
1091212266 11:133872165-133872187 ACAGAGCTCTTCAAAAATCCTGG - Intergenic
1091282926 11:134392089-134392111 ATAGGGCTCTGCGAAGATGAAGG + Exonic
1091883418 12:3998359-3998381 ACGAGGCTCTTCAAAGGGGCTGG - Intergenic
1092012621 12:5127485-5127507 ACAGTGCTCTTCATGGATGCTGG + Intergenic
1092093023 12:5819721-5819743 ATAGGGCCCTTCAAAGATGCAGG - Intronic
1092359111 12:7821288-7821310 ACAGGAATCTTCAAGGATGCAGG - Exonic
1092372193 12:7925911-7925933 ACAGGAATCTTCAAGGATGCAGG - Exonic
1092381034 12:7997283-7997305 ACAGGGCTCCTCAAAGATGCAGG - Intergenic
1093036048 12:14333428-14333450 ACAGGTCCCTTCAAAGATACAGG - Intergenic
1093049913 12:14492869-14492891 AGAGGGCTCTTCAGAGATTCAGG + Intronic
1093392342 12:18637698-18637720 ACAGAGCTTTTCAAGGATGCTGG + Intronic
1093960361 12:25265892-25265914 AGAAGGCCCTTGAAAGATGCTGG - Intergenic
1093964298 12:25309042-25309064 ACAGACCTCTTTAAGGATGCAGG - Intergenic
1094102284 12:26777350-26777372 ACAGACCTCTTCAAAGATGCAGG - Intronic
1094326922 12:29250837-29250859 ACAGAGCTCCTCTAGGATGCTGG - Intronic
1095506677 12:42905937-42905959 GCAGGGCTGTCCAAAGATGTAGG - Intergenic
1095603830 12:44044175-44044197 ACAGGGCTCTTCAAAGACACAGG - Intronic
1095844722 12:46732396-46732418 ACAGGTCTCCTCAAAAATGCAGG + Intergenic
1096053288 12:48629745-48629767 ACAGAGCTCTTCAAGGATGCCGG - Intergenic
1096296759 12:50390721-50390743 ACAGAGCTCTTCAAGGATGCCGG + Intronic
1096361150 12:50988464-50988486 TCATGGCTCTTCAAAGAGCCTGG - Intronic
1096457740 12:51801342-51801364 ACAGAGCTCTTCAAGGATGCAGG + Intronic
1096734592 12:53642785-53642807 ACAGAGCTCTTTGAGGATGCTGG - Intronic
1096760482 12:53837639-53837661 ACAGGGGGCTTCTAAGGTGCTGG - Intergenic
1097076612 12:56399581-56399603 ACAGGGCTCTTCAAAGATTCAGG - Intergenic
1097314146 12:58154040-58154062 ACAGAGATCTTCGAAGATGTTGG + Intergenic
1097555633 12:61134041-61134063 ACAGAGCTCTTCAAAGATTGTGG - Intergenic
1097843615 12:64344673-64344695 ACAGGGCTCTTCAAAGATGCAGG + Intronic
1097978329 12:65711222-65711244 ACAGTGCTCTGCAAAGACTCAGG + Intergenic
1098104173 12:67052263-67052285 ACAGGGATCTCCAAACATCCTGG + Intergenic
1098672795 12:73252338-73252360 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1098715847 12:73827901-73827923 ACAGGGCTCTTCAAAACTTCAGG - Intergenic
1098730809 12:74035441-74035463 ATAGTGCTCTTCAAAAATTCAGG - Intergenic
1098749591 12:74277582-74277604 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1098805202 12:75014168-75014190 CAAGGGCTCTTCAAAGATGCAGG - Intergenic
1099184048 12:79498584-79498606 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1099375397 12:81892059-81892081 TATGGGCTTTTCAAAGATGCAGG - Intergenic
1099379910 12:81940659-81940681 ACAAGGCTCTTCAAAGATGCAGG + Intergenic
1099400204 12:82194346-82194368 ACAGAGCACTTCAAGGATGAAGG - Intergenic
1099508186 12:83503971-83503993 ACAGAGCTCTTCAAGAATGCAGG - Intergenic
1099526136 12:83721235-83721257 ACAGGGCTCTTCAAAGATGTAGG - Intergenic
1099577846 12:84403534-84403556 ACAGGGCCCCCCAAAGATGCAGG - Intergenic
1099859645 12:88210533-88210555 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1100083069 12:90876320-90876342 ACAGGGCTCTTCAATGATGCAGG - Intergenic
1100241418 12:92713602-92713624 ACAGGGCTCTTCAAAAATGCAGG + Intergenic
1101263868 12:103064195-103064217 ACAGGGCTCTGCAAAGATGCAGG - Intergenic
1101534931 12:105608017-105608039 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1102211490 12:111130569-111130591 TCAGAGCTCTTCAAGGATGATGG + Intronic
1102512395 12:113424573-113424595 ACAGGGCACCTACAAGATGCAGG - Intronic
1103035319 12:117651823-117651845 ACAGGGCTCTTCAAAGATGTAGG - Intronic
1103396262 12:120609537-120609559 ACAGGGCTCCTCAGGGATGCAGG - Intergenic
1105328844 13:19395518-19395540 ACGGGGCTCCTCAAAGCAGCTGG + Intergenic
1105700184 13:22929902-22929924 GCAGAGCTCTTCAAGGAAGCTGG + Intergenic
1105852961 13:24351852-24351874 GCAGAGCTCTTCAAGGAAGCTGG + Intergenic
1105863094 13:24434319-24434341 ACGGGGCTCCTCAAAGCAGCTGG - Intronic
1105972263 13:25440133-25440155 AAAGAGCTCTACACAGATGCTGG + Intronic
1106399793 13:29418726-29418748 ACAGAGTTCTTCTAAGATGTTGG + Intronic
1107275514 13:38674110-38674132 ACAGAGCTCTTCAAGGATGCTGG - Intergenic
1107527617 13:41248605-41248627 ACAGAGCTCTTGAAGGATGCTGG + Intronic
1107983823 13:45757878-45757900 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1109306918 13:60651114-60651136 ACAAAGCTCTTTAAAGATGCTGG - Intergenic
1109460007 13:62644184-62644206 ACAGAGCTCTTCAAAAATGCTGG - Intergenic
1109516029 13:63443391-63443413 ACAGGGCTCTTCAAAGACACAGG - Intergenic
1109582813 13:64364228-64364250 ACAGGGCTCTTCAAAAATTCAGG - Intergenic
1109712921 13:66182807-66182829 ACAGAGCTCTTCAAGGATGCAGG + Intergenic
1109839814 13:67906733-67906755 ACCTGGGTCTTCCAAGATGCTGG - Intergenic
1109951260 13:69504081-69504103 ACAGGACCCTTCAAAGGTGCAGG + Intergenic
1110376932 13:74804577-74804599 ACAGGACTCTTCAAAGATGCAGG - Intergenic
1111016432 13:82387731-82387753 ACAGGGCTATTCAGAGATGCAGG + Intergenic
1111046827 13:82824541-82824563 ACAGGGCAATTCTAAAATGCAGG - Intergenic
1111576001 13:90154677-90154699 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1112231381 13:97592069-97592091 ACAGGGTCCTTCAAAGATGCAGG + Intergenic
1112250178 13:97772133-97772155 ACAGGGCTCTTCAAAGACGCAGG + Intergenic
1112882193 13:104122041-104122063 ACAGGGCTCTGAGCAGATGCTGG + Intergenic
1113319966 13:109223587-109223609 ACAGGGCTTTTCAAAGATGTAGG + Intergenic
1115059458 14:29171989-29172011 ACAGGGCTTTTCAAAGATGCAGG - Intergenic
1116058660 14:39895029-39895051 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1116067835 14:40007255-40007277 ACAGAGCTCTTCAAGGATGCGGG - Intergenic
1116158632 14:41238587-41238609 ACAGAGCTCTTCAAAGATTCGGG + Intergenic
1116414827 14:44667402-44667424 ACACAGCTCTTCAAAGATGCAGG - Intergenic
1117216578 14:53558195-53558217 ACAAGGCTCTTCAAAGATGCAGG - Intergenic
1117596525 14:57331801-57331823 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1117633870 14:57722474-57722496 ACAGGGCTCTTCAAAGATGCAGG - Intronic
1117899792 14:60519998-60520020 ACAGGTCTCTTCCAAGGTCCTGG - Intergenic
1118032353 14:61830903-61830925 ACAGGGCTCTTCACAGTGCCTGG + Intergenic
1118881013 14:69825928-69825950 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1118950814 14:70434994-70435016 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1119059950 14:71464060-71464082 ACAGTGCTTTTCACAGATGCAGG + Intronic
1119107827 14:71940754-71940776 ACAGGGCTCTTCAAAGATGCAGG + Intronic
1119444259 14:74650153-74650175 ACAGGGCACATCCAAGATGCAGG + Intergenic
1120082282 14:80229455-80229477 ATAGGGCTCTTCAAAGATGCAGG + Intronic
1120556246 14:85932351-85932373 ACAGGTCTCTTCAAAGATGTAGG + Intergenic
1120562851 14:86018128-86018150 TCAGAGGTCTTCAAGGATGCTGG + Intergenic
1121371123 14:93359381-93359403 ACAGGGCTTTTCAAAGATGCAGG - Intronic
1122105367 14:99449553-99449575 GCAGTGCTCTTCAAAAGTGCCGG + Intronic
1122131045 14:99604594-99604616 ACAGGGCGCTTTTAAAATGCAGG + Intergenic
1122374570 14:101249281-101249303 GCAGGGCTCTCCCAGGATGCAGG + Intergenic
1123193280 14:106591886-106591908 ACAGGCGTCTTCCCAGATGCTGG + Intergenic
1202935546 14_KI270725v1_random:84259-84281 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1123502165 15:20898118-20898140 AAACTGCTCTTCAAAGATGAAGG + Intergenic
1123559415 15:21471801-21471823 AAACTGCTCTTCAAAGATGAAGG + Intergenic
1123595649 15:21909101-21909123 AAACTGCTCTTCAAAGATGAAGG + Intergenic
1123765552 15:23474778-23474800 ACAGAGCTTTTGAAGGATGCTGG + Intergenic
1123824814 15:24070406-24070428 ACAGAGCTCTTCAGGGATGCTGG + Intergenic
1125281914 15:38050995-38051017 ACAGGGCTCTTCCAAGGCCCTGG + Intergenic
1127405584 15:58641702-58641724 ACAGGTCTCTGAAAGGATGCAGG - Intronic
1127682201 15:61308836-61308858 ACATCCCTCTTAAAAGATGCTGG + Intergenic
1129117089 15:73370392-73370414 ACAGTTCTCTGCACAGATGCTGG + Intergenic
1129961647 15:79691969-79691991 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1130771853 15:86932185-86932207 ACAGGGCTCTTCAAATGGGAGGG - Intronic
1202967761 15_KI270727v1_random:198961-198983 AAACTGCTCTTCAAAGATGAAGG + Intergenic
1133052673 16:3126093-3126115 ACAGAGCTCTTCAAGGATTCAGG + Intergenic
1134382403 16:13740174-13740196 ACAGGTGTCTTCCCAGATGCTGG - Intergenic
1134784064 16:16924963-16924985 CCAGAACTCTTCAAAGATGCTGG + Intergenic
1135292865 16:21255237-21255259 ATAGGGCTCTTTAATCATGCAGG - Intronic
1135625777 16:23993588-23993610 ACAGAGCTCTTAAAGGACGCTGG - Intronic
1138868139 16:60848870-60848892 ACGGGGCTCTTCAAAGATGCAGG - Intergenic
1138943604 16:61820625-61820647 ACAGGGCACTTCAATTATGTGGG - Intronic
1139099916 16:63753367-63753389 ACAGGGCTCCACCAAGAAGCTGG - Intergenic
1140846719 16:78896069-78896091 AAAGGGCTCTGAAAACATGCAGG + Intronic
1140997620 16:80276815-80276837 GCAGGGCTGTTCATAGATTCTGG - Intergenic
1142853241 17:2715358-2715380 ATTGGGCTCTGGAAAGATGCTGG - Intergenic
1143316109 17:6034724-6034746 GCAGGGCTCTTCAAACTTGGAGG - Intronic
1144565453 17:16355391-16355413 AAAGGACTCTTCTAAGATGCTGG + Intergenic
1144747262 17:17624120-17624142 ACAGTGCTCATCAAGGATGGTGG + Intergenic
1146850674 17:36219114-36219136 ACAGGGCTCTTCAAAGATGCTGG - Intronic
1146983295 17:37186686-37186708 TCAGGGCTTTTAAAATATGCAGG + Intronic
1147838072 17:43349273-43349295 ACAGGTGTCTTCCCAGATGCTGG + Intergenic
1148907333 17:50919722-50919744 CCAGGGCTCTGCACCGATGCCGG - Intergenic
1149236259 17:54594156-54594178 ACAGGACTCTTCAAAGATGCAGG + Intergenic
1149753650 17:59169584-59169606 TCAGGGCTCTTCTGGGATGCTGG + Intronic
1151037867 17:70822123-70822145 ACGGGGCTCTTCAAAGATGTGGG + Intergenic
1151347504 17:73511140-73511162 AAAGGGCTCTTGAAAGCTGCTGG - Intronic
1151631775 17:75315874-75315896 ACAGGGCTCCTGTAAGATGCTGG + Intergenic
1152178465 17:78802837-78802859 GCAGGGCCGTTCAAGGATGCTGG - Intronic
1152682457 17:81676084-81676106 ACAGGCGTCTTCCCAGATGCTGG - Intergenic
1153131527 18:1859636-1859658 ACAGGTCTCTTCAAAGATGCAGG + Intergenic
1153217957 18:2837521-2837543 ATAGGGCTCTTCAAAGATGCAGG + Intergenic
1153461268 18:5336192-5336214 ACAAAGGTCTTCAAAGATGTTGG + Intergenic
1153524315 18:5980064-5980086 ACAGAGCTCAGCACAGATGCTGG + Intronic
1154252995 18:12759510-12759532 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1154505941 18:15040957-15040979 ACAGCACTCTTCAAAGATGCAGG - Intergenic
1155304115 18:24462592-24462614 ACGGTGCTCTTCAAAGAAACAGG + Intronic
1155573586 18:27221297-27221319 ACAGAGCTCTTCAAGGATGTAGG - Intergenic
1155742002 18:29299817-29299839 ACAGAGCTCTTCAAGGATGCAGG + Intergenic
1156192298 18:34733624-34733646 ACAGAGCTCTTCAAAGATGCAGG + Intronic
1156303619 18:35856825-35856847 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1156537539 18:37878613-37878635 ATAGGGCCCTTCAAAGATACAGG - Intergenic
1156990536 18:43402613-43402635 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1157737760 18:50065675-50065697 ACAGGGCCCTTCAAGGATCCCGG + Intronic
1157845929 18:51004056-51004078 AAAGAGCTCTTCAAGGATGCTGG - Intronic
1157871227 18:51231825-51231847 ACAGAGGTCTTCAAGGATGCTGG + Intergenic
1157911134 18:51618216-51618238 ACAGAGCTACTCAAGGATGCTGG - Intergenic
1159168595 18:64734437-64734459 AAAGGGCTCTTCAAACATTTTGG - Intergenic
1159272559 18:66171150-66171172 ACAGAACTCTTTAAGGATGCTGG + Intergenic
1159287534 18:66373555-66373577 TCAGGGCTCTTCAAAGATGCGGG - Intergenic
1159422032 18:68233862-68233884 ACTGGGCTTCTCAAAGATTCTGG + Intergenic
1159455758 18:68658744-68658766 AGAGAACTCTTCAAAAATGCTGG - Intergenic
1159559334 18:69977078-69977100 TCAGGGCTCTTCAAAGATGAAGG + Intergenic
1159831667 18:73284923-73284945 CCAGGGCTCTTCAGAGAAACAGG + Intergenic
1161261401 19:3339835-3339857 TCAGGGCTTTTCAAAGCTGTGGG + Intergenic
1162191274 19:8948870-8948892 GCTGGTCTCTTCAGAGATGCTGG + Exonic
1164097374 19:22023576-22023598 ATAAGGTTCTTCAAAGATTCAGG + Intergenic
1164117560 19:22237025-22237047 ACAAGGTTCTTTAAAGATTCAGG + Intergenic
1164200267 19:23012305-23012327 ACAGGGCTCTTCAAAGATTCAGG + Intergenic
1164931566 19:32179759-32179781 AGTGGGGACTTCAAAGATGCTGG - Intergenic
1165533121 19:36420743-36420765 ACAAGGCTCTGTAAAGACGCAGG - Intergenic
1167675532 19:50882437-50882459 ATATAGCTCTTCAAGGATGCTGG - Intergenic
1167951224 19:53029338-53029360 ACAGAGCTCTCCAAGGATGCAGG - Intergenic
1168539613 19:57199267-57199289 ACAGGGCTCTTCAAAGATGCAGG + Intronic
925350601 2:3198508-3198530 ACAAGGCTCTGCAAGGATGGTGG - Intronic
925460474 2:4058561-4058583 ACAGGGCTCTTCAAAAATGCAGG - Intergenic
925499645 2:4488823-4488845 ACAGGGTTCTCCAAAGATGCAGG + Intergenic
926810641 2:16752595-16752617 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
926825837 2:16904269-16904291 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
929270083 2:39962689-39962711 ACAGGGCTTTTCAAGGATGCAGG + Intergenic
929549965 2:42883819-42883841 ACAGAGCTCTCCAGGGATGCTGG - Intergenic
929570837 2:43022007-43022029 ACAGGGCTGCCCACAGATGCAGG - Intergenic
930372929 2:50527174-50527196 ACAAGGATTTTCTAAGATGCAGG + Intronic
930456515 2:51613681-51613703 ACAGGGCCCTTAAAAGATGGAGG + Intergenic
930483815 2:51986574-51986596 ACAGGCCTCTTCACAAATGTTGG + Intergenic
930536838 2:52654169-52654191 ACAGGACTCTTCAAAAATGCAGG + Intergenic
930697646 2:54428265-54428287 ACAGGGGGCTTCCAGGATGCTGG + Intergenic
930852419 2:55975034-55975056 ACAGAGCTCTTCAAGGATGCTGG + Intergenic
930909907 2:56618947-56618969 ACAGGGCTCTTCAAAGGTGCAGG - Intergenic
930939546 2:56997711-56997733 ACAGGGCTATTACAATATGCTGG + Intergenic
933265959 2:80180637-80180659 ACAGAGCCCTTCAAGGATGCAGG + Intronic
934305666 2:91820021-91820043 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
934327590 2:92032721-92032743 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
934465977 2:94263300-94263322 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
935425348 2:102913239-102913261 ACAAGGCTCTTCAAAGATGCAGG + Intergenic
935564567 2:104592178-104592200 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
935935206 2:108174960-108174982 ACAGAGCTCTTCAGAGACCCTGG - Intergenic
936868941 2:117109976-117109998 GCAGGCCTCTTCCAAGATGGTGG - Intergenic
937006726 2:118523328-118523350 ACAGAGTTCTTTAAAGAAGCTGG - Intergenic
937146061 2:119645756-119645778 ACAGACCTCCTCACAGATGCTGG - Intronic
937301654 2:120846434-120846456 AGGGGGCTCTTCACAGCTGCTGG + Intronic
937785446 2:125889630-125889652 ACAGGACTCTTCAAAGATGCAGG + Intergenic
937800078 2:126072836-126072858 ACAAAGCTCTTCAAGGATGCAGG - Intergenic
938572976 2:132578553-132578575 ACAGGGCTATTCAAATAATCTGG + Intronic
938726624 2:134114377-134114399 ACAGAGCTCTCCAAAAATGCTGG + Intergenic
939068832 2:137515944-137515966 ACAGGCCTCCTCAAAGATGCAGG - Intronic
939213572 2:139210000-139210022 ACAGGGCTTTTCAAAGATGCAGG - Intergenic
939788926 2:146547991-146548013 ACAGGACTCTTCAAAGATGCAGG + Intergenic
939805994 2:146776560-146776582 ACAGAGCTCTTCAAGGTTGCAGG - Intergenic
940606168 2:155926286-155926308 ACAGGCCTCTTCAAAGATGCAGG + Intergenic
941010184 2:160290772-160290794 AGATGGCTCTTAAGAGATGCCGG - Intronic
941350683 2:164430377-164430399 ACAGGGTTCTTCAAAGCTGTGGG - Intergenic
941667753 2:168259266-168259288 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
942987673 2:182162126-182162148 ACAGAGATCTTTAAGGATGCTGG - Intronic
943006322 2:182391567-182391589 ACAGAGCTCTTCAAGGATGTAGG - Intronic
943239453 2:185364507-185364529 ACAGGACTCTTCAAAGATTCAGG + Intergenic
943265206 2:185722065-185722087 ACAGAGCTCTTCAAGGATGCTGG - Intergenic
943318091 2:186413569-186413591 ACAGAGCTCTTCAAAAATGCAGG + Intergenic
943384270 2:187182789-187182811 ACAGGGCTCTTCAAAGGTACAGG + Intergenic
943517850 2:188909153-188909175 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
945514699 2:210748791-210748813 ACAGAACTCTTCAAGGATGCTGG + Intergenic
945726067 2:213473399-213473421 ACAGGGCTCTTCAAAGATGCGGG + Intronic
946528117 2:220541878-220541900 ACAGGGTTCTTCAAAGATGCAGG + Intergenic
946790681 2:223297839-223297861 ACAGAGCTCTTCAAGGATGCAGG - Intergenic
947798392 2:232909270-232909292 ACACGGATCTTCAAAGAGGATGG - Intronic
1169735944 20:8837744-8837766 ACAGAGCTCTTCAAGGATGCTGG - Intronic
1171296446 20:24021184-24021206 ACAGGGCTCTTCAGAGATGCAGG - Intergenic
1171330310 20:24331579-24331601 ATAGAGCTCTTCAAGGATGCTGG + Intergenic
1171410074 20:24940556-24940578 ACAGAGGTCTTCAAAGATGCTGG + Intergenic
1172839086 20:37891221-37891243 ACAGGGGTCTTCAGAGACCCAGG - Intergenic
1173709389 20:45141157-45141179 ACAGGGCTCTTCAAAGATGAGGG + Intergenic
1173881981 20:46422248-46422270 AAAGGGCTATTCAAAGATGATGG - Intronic
1174036201 20:47669708-47669730 ACAGGGCTGTTGAGAGGTGCAGG + Intronic
1176596971 21:8706495-8706517 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1176791917 21:13328069-13328091 ACAGCACTCTTCAAAGATGCAGG + Intergenic
1176997905 21:15578313-15578335 ACAGGGCTCTTCTAAGAGGCAGG - Intergenic
1177002872 21:15635458-15635480 ACAGGGCTCTTCGAAGATGCAGG + Intergenic
1177363485 21:20103938-20103960 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1177505859 21:22016434-22016456 ACAGGGCTCTTCAACGATGCAGG + Intergenic
1177912944 21:27054315-27054337 ACAGTCCTCTTCAAAGATGCAGG - Intergenic
1177933939 21:27318835-27318857 ATAGGGCTCCTCAAAGATGCAGG + Intergenic
1177944531 21:27450952-27450974 ACAGTGCTGTTCAAAGGTGAGGG - Intergenic
1177991311 21:28039071-28039093 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1178012390 21:28303003-28303025 ACAGAGCTCCTCAGAGATGCAGG - Intergenic
1178061810 21:28861110-28861132 ACAAGACTCTTCAAAGATGCAGG - Intergenic
1178764071 21:35432847-35432869 ACAGGGCTCTTCAAAGATGCAGG + Intronic
1179279288 21:39920835-39920857 CCAGGGCTCTTCACGGATGGTGG - Intronic
1179383278 21:40919161-40919183 ATAGAGCTCTTCAGGGATGCTGG - Intergenic
1179390010 21:40979797-40979819 AGAGGGCCCTTCCCAGATGCCGG + Intergenic
1179622814 21:42630033-42630055 GCAGGGCTCTCCAGAGAGGCAGG - Intergenic
1180201175 21:46225347-46225369 ACGGGCCTCTTCCCAGATGCTGG - Intronic
1180279894 22:10683937-10683959 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1180587111 22:16902473-16902495 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1180591393 22:16940291-16940313 ATAGGGCTCTTCAAAGATGCAGG + Intergenic
1181854016 22:25769466-25769488 ACAGGCCTCTCCAGAGATGCAGG + Intronic
1182416452 22:30224333-30224355 TCAGGGCTCTGCAAGGTTGCCGG + Intergenic
1183760209 22:39809686-39809708 ACAGAGCTCTTCAGAGATGCTGG - Intronic
1184499896 22:44865307-44865329 ACAGGGCCCATCAAATATGGCGG + Intergenic
1184603821 22:45560308-45560330 ACAGGGCTCTTCAAAGATGCAGG + Intronic
1184639007 22:45859065-45859087 ACAGAGCTCTTCAAGGAGCCCGG + Intergenic
1185033409 22:48457943-48457965 ACAGGGCACTTCAACAAAGCTGG - Intergenic
949125911 3:445071-445093 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
949170289 3:988493-988515 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
949245622 3:1922995-1923017 ACAGAGCTCTTCTAAGAGGCAGG - Intergenic
949417902 3:3833103-3833125 ACAGGGCTCTTCAGAGATGCAGG + Intronic
949638535 3:6010615-6010637 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
951003327 3:17590588-17590610 ATAGGGCTCTTGAAAGATGCAGG - Intronic
951122349 3:18943655-18943677 ACAGGGCTCTTCAAAGATACAGG - Intergenic
951384297 3:22025829-22025851 ACAGGGCTCTTCGAAGATGCAGG - Intronic
951571312 3:24066010-24066032 ACAGGGCTCTTCAAGGATGCTGG + Intergenic
951851012 3:27139904-27139926 ACAGGGCTTTTCAAGGATGCTGG - Intronic
951853605 3:27170230-27170252 GCAGGGCTCTTCAGAGCTGTGGG - Intronic
952344777 3:32473190-32473212 AAAGGGCTCTTCAAAGGTTCAGG - Intronic
952531807 3:34270697-34270719 ACAGTTCTATTCAAATATGCAGG + Intergenic
953308602 3:41854313-41854335 TTAGAGCTCTTCAAAGATGCTGG - Intronic
953897645 3:46814413-46814435 ACAGGACCCTTCAAAGATGCAGG + Intergenic
954048634 3:47954074-47954096 ACAGAGCTTTTCAAGGATGAAGG - Intronic
955035335 3:55262179-55262201 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
956509393 3:69978438-69978460 ACAAGGCTCTTCAAAGATGCAGG - Intergenic
957828125 3:85477466-85477488 ACAGGACTTTTCACAGATGATGG + Intronic
957897875 3:86446914-86446936 ACAGGGCTCTTAAAAAATGCAGG - Intergenic
958036267 3:88173472-88173494 ACAGAGCTCTTCAAGGATGCTGG - Intergenic
958469229 3:94497213-94497235 ACTGGGATTTTCAAAGATTCTGG + Intergenic
958789090 3:98630502-98630524 ACAGGGATCTTCAAAGATGCAGG + Intergenic
958845775 3:99262441-99262463 ACAAGGCCCTTCAAAGTTGCAGG + Intergenic
958934058 3:100238714-100238736 ACAGGGCTCTTCAAAAATGCAGG - Intergenic
959204042 3:103282766-103282788 ACAGGGTTCTTCAAAGATGCAGG + Intergenic
959227017 3:103599210-103599232 ACAGGGCTCTCCAAAGATGCAGG + Intergenic
959377637 3:105605080-105605102 ACAAGGCTCTTCAAAGACACAGG + Intergenic
959581684 3:107989043-107989065 ACAGGGCTGCCCCAAGATGCAGG - Intergenic
960494987 3:118362707-118362729 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
960753898 3:120987589-120987611 ACAGGGTTCTTCACAGAGGACGG + Intronic
961523171 3:127479850-127479872 AACGCGCTCTTCAAAGAAGCAGG + Intergenic
963355911 3:144208760-144208782 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
963453480 3:145515183-145515205 ACAGGCCTCTTCAAAGATGCAGG - Intergenic
963548871 3:146696186-146696208 ACAAAGCTCTTGAAAGATTCTGG + Intergenic
963566666 3:146939080-146939102 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
963630057 3:147721309-147721331 ACAGGACTCTCCAGTGATGCAGG - Intergenic
963661138 3:148130222-148130244 ATAGAGCTCTTCAAGGATGCGGG - Intergenic
965227011 3:166002680-166002702 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
966044566 3:175532833-175532855 ACAGGGCTCTTCAAAGATGCAGG + Intronic
966430066 3:179822073-179822095 AAATAGCTTTTCAAAGATGCAGG + Intronic
966445434 3:179996646-179996668 ACAGGGCTCTTCAAAGATGCAGG - Intronic
967170019 3:186815749-186815771 AGAAGGCCCTTGAAAGATGCTGG + Intergenic
967831522 3:193924070-193924092 ACAGTGCTCTTCAAAGATGCAGG - Intergenic
968505333 4:968659-968681 ACAGGACACTTAAAGGATGCAGG - Intronic
968906620 4:3455709-3455731 ACAGGGCCCTTCAAAGACGCAGG - Intergenic
969460898 4:7328373-7328395 TCAGGGCTCTTCTAGGAGGCAGG + Intronic
969817745 4:9698793-9698815 ACAGGGCTCTTGAGAGAAGGTGG + Intergenic
970089439 4:12388263-12388285 ACAGGGCTCTTCAAAGATTCAGG + Intergenic
970941546 4:21640357-21640379 ACAAAGCTCTTCAAGGATGCAGG + Intronic
971002886 4:22341929-22341951 ACAGAGCTCTTCAAGGATGCAGG - Intergenic
971101262 4:23468340-23468362 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
971739536 4:30502595-30502617 ACAGAGTTCTTCAAGGATACTGG - Intergenic
971979541 4:33734777-33734799 TTAGGGCTCTTCAGAGATGAAGG + Intergenic
972084991 4:35205116-35205138 ACAGGCCTCTTCAAAGATGCAGG - Intergenic
972095264 4:35340767-35340789 ACAGGGCTCTTCAAAGATCCAGG - Intergenic
972192658 4:36613350-36613372 ACAGGACTCTTCAAAAATGCAGG - Intergenic
972201535 4:36719062-36719084 ACCGGGCTCTTTGAAGATGCAGG + Intergenic
972321270 4:37975596-37975618 ACAGGCGTCTTCCCAGATGCTGG + Intronic
972883218 4:43450067-43450089 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
973102696 4:46292857-46292879 ACAGGGCTCTTCAAAGATGGAGG - Intronic
973118194 4:46487128-46487150 ACAGGGTTCTTAAAAGATGCAGG - Intergenic
973143255 4:46794552-46794574 ACAGAGCTCTTTAAGGATGCTGG - Intronic
973198873 4:47477296-47477318 ACAGTGAACTTCAAAGGTGCTGG - Intergenic
974262619 4:59544194-59544216 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
974458918 4:62163323-62163345 ACAGAACTCTTCAAAGACGCAGG - Intergenic
974493358 4:62595460-62595482 ACAGGTGTCTTCCCAGATGCTGG - Intergenic
974644861 4:64676690-64676712 ACAGGGTTCTTCAAAAATGCAGG + Intergenic
974726836 4:65809549-65809571 ACAGAGCTCTTCAAGGATGCAGG - Intergenic
974747160 4:66090841-66090863 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
975051266 4:69867651-69867673 ACAGAGCTCTTCAAGGATGTTGG - Intergenic
975377847 4:73666092-73666114 ACAGGCGTCTTCCCAGATGCTGG + Intergenic
975378480 4:73671504-73671526 ACAGGCGTCTTCCCAGATGCTGG + Intergenic
975982868 4:80179189-80179211 ACTGGGCTCGTCAAAGATGCAGG + Intergenic
976034434 4:80797679-80797701 ACAGGGCTCTTCAAAGATGCAGG + Intronic
976940488 4:90696340-90696362 AGATGGCTCTTCTAATATGCTGG + Intronic
977204450 4:94153705-94153727 ACAGAACTCTTTAAAGATGCTGG - Intergenic
977430510 4:96926307-96926329 GCAGGGCTCTTCAAAGATGCAGG - Intergenic
977465752 4:97381489-97381511 ACAGAGCTCTTCAAAGATGCAGG - Intronic
977490334 4:97701974-97701996 ACAGAGCTCTTCAAAGATGCAGG + Intronic
978200259 4:106017251-106017273 ACAGGGCTCTAAGCAGATGCTGG + Intergenic
978341905 4:107728180-107728202 ACAGGGCTCTTCAAAAATGCAGG + Intergenic
978665103 4:111172960-111172982 ACAGAACTCTTCAAGGATGCTGG - Intergenic
978899325 4:113928758-113928780 ACAGGGCTCTTCAAAGATGCAGG + Intronic
978966606 4:114749025-114749047 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
979017958 4:115458808-115458830 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
979075472 4:116264485-116264507 TCAGGGCTGTTCATAGATGCAGG - Intergenic
979099227 4:116594261-116594283 ACAGGGCTATTTGAAGCTGCTGG - Intergenic
979766782 4:124472884-124472906 ACAGTACCCTTCAAAGATGCAGG - Intergenic
979898645 4:126190948-126190970 ACAGAGCTTTTCAAGGATGTAGG + Intergenic
980406139 4:132355717-132355739 ATAGGGCTCTTAAAAGATTCAGG + Intergenic
980497780 4:133607292-133607314 ACAGGGTTCTTCAAAGACGCAGG + Intergenic
980628417 4:135405706-135405728 ACAGGGCTCTTCAGAGATGCAGG - Intergenic
981462546 4:145029881-145029903 ATAGGGCTCTTCAAAAATGGGGG - Intronic
981834603 4:149040548-149040570 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
982526952 4:156490485-156490507 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
982835265 4:160114652-160114674 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
982934496 4:161454690-161454712 ACTGGGCTCTTACAAAATGCTGG - Intronic
982995047 4:162332989-162333011 ACGGGTCTCTTCCAAGTTGCAGG + Intergenic
983184814 4:164689689-164689711 GAAGGGCTCTTCGAAGATGCAGG - Intergenic
983199266 4:164843351-164843373 ACAGGTCTCTTTTAAGATTCTGG - Intergenic
983359113 4:166705881-166705903 ACAGAACTCTTCAAGGATGCAGG - Intergenic
984061317 4:174991723-174991745 ACAGGGCACTTCAAAGATGCAGG + Intergenic
986086868 5:4460795-4460817 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
986291271 5:6400937-6400959 ACAGGGCTCCTCAGAGAAGGGGG - Intergenic
986938566 5:12920655-12920677 ACAGGACTCTTCCAAGATCCAGG + Intergenic
986955782 5:13148052-13148074 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
986959588 5:13197285-13197307 ACAGGGCTCTTTAAAGATACAGG - Intergenic
987152925 5:15059750-15059772 ACAAGGCTCTTCAGAGATGCAGG - Intergenic
987491087 5:18581142-18581164 ACAGACTTCTTCAAGGATGCTGG + Intergenic
987578604 5:19760253-19760275 GCAGGGCTCTTTAAAGATGCAGG + Intronic
987621578 5:20342989-20343011 ATAGGGCTCTTCAAAGATGCAGG - Intronic
987657371 5:20823560-20823582 ACAGGGTGCTTCAAAGATGCAGG + Intergenic
988080069 5:26403340-26403362 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
988107522 5:26770602-26770624 ACAGGTCTCTTCAAAGATGCAGG - Intergenic
988161058 5:27518794-27518816 ACGGGGCTCTTCAAAGAGGCAGG + Intergenic
988169434 5:27634734-27634756 ACAGGGCTCTTCAAAGACGCAGG + Intergenic
988267739 5:28973279-28973301 ACAGGACTCTTCAAAGATGCAGG + Intergenic
988766173 5:34380386-34380408 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
988851252 5:35183454-35183476 ACAGGGCTCTTGATATATCCTGG + Intronic
989045564 5:37270152-37270174 ACAGGGCTCTTCAAAGATACAGG + Intergenic
989097530 5:37795084-37795106 ACAGGGCCCTTCAAAGATGCAGG - Intergenic
989457901 5:41663690-41663712 ACAGGGATCTTCAAAAATGCAGG + Intergenic
989486629 5:41998295-41998317 ACAGGCGCCTTCAAAGATGCAGG + Intergenic
990483618 5:56236040-56236062 ACAGAACTCTTCAAAGATGCTGG - Intergenic
991014068 5:61912819-61912841 ACAGGGCTCTCCAAAGATGCAGG + Intergenic
991033297 5:62103985-62104007 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
991639950 5:68742236-68742258 ACAGAGCTATTCAAATAGGCAGG - Intergenic
991945893 5:71898221-71898243 ACAAGGCTCTTCAAAGATGCAGG - Intergenic
993319589 5:86456676-86456698 ACAGGGCTCTTCAAAGATACAGG - Intergenic
993412827 5:87593733-87593755 ACAGGGCTCTTCAGAAATGCAGG + Intergenic
993791541 5:92217001-92217023 AGAGGGCCCTTAAAAGATGCAGG - Intergenic
993904241 5:93605009-93605031 ACAGGGGGTTTTAAAGATGCTGG + Intergenic
994291625 5:98033890-98033912 ACAGGCCTCTTCAAAGATGCAGG + Intergenic
994836884 5:104866236-104866258 ATAGGGCTCTTCAAAGATTCAGG - Intergenic
994984668 5:106917643-106917665 ATAGGGCTCTTCAAAGATGCAGG + Intergenic
995259115 5:110081439-110081461 TCAGGGGTCTTCAAGGATGGTGG - Intergenic
995269803 5:110207382-110207404 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
995427990 5:112045691-112045713 ACAGAGCTCTTCAAGGATGCAGG + Intergenic
995776543 5:115729595-115729617 ACAGGGCTCTTCAAAGATTCAGG + Intergenic
996165195 5:120214427-120214449 ACAGAGCTCTTCAAGGATGCAGG + Intergenic
996825311 5:127675909-127675931 ACAGGGCTATTCAAAGATGTGGG - Intergenic
996908938 5:128633944-128633966 ACAGAGCTCTTCAAGGACGCAGG + Intronic
997231627 5:132248970-132248992 AGAAGGCCCTTGAAAGATGCTGG - Intronic
998290579 5:140910497-140910519 ACAAAGCTCTTCAAGGATGCAGG + Intronic
1000416718 5:160992005-160992027 ACAGGGCTTTTCAAATATTCAGG - Intergenic
1000423089 5:161059906-161059928 ACGGAGCTCTTCAGGGATGCTGG + Intergenic
1001413727 5:171528698-171528720 ACAGGGCCCCTCACAGATGCTGG + Intergenic
1001867885 5:175121261-175121283 ACAGGGCCCTCTAAAGAAGCTGG + Intergenic
1002171037 5:177374471-177374493 ACAGAGATCTTCAATGAGGCAGG - Intergenic
1002983342 6:2163873-2163895 ACAGAGCTCTTCCAGGATGCTGG + Intronic
1003696150 6:8408016-8408038 ACAGGGGTCTTCAAAGATGCAGG + Intergenic
1003758352 6:9148128-9148150 ACAGGGGTCATCAAAGATGCAGG - Intergenic
1004592252 6:17064008-17064030 ACAAGTCTCTTCCAAGATCCTGG - Intergenic
1004622394 6:17342524-17342546 ACAGAGCTCTTCAGGGATTCAGG - Intergenic
1004824549 6:19405149-19405171 ACAGGGCTCTTCAAAAATGCAGG + Intergenic
1005622713 6:27634900-27634922 ATAGGGCTCTTCAAAGATGCAGG + Intergenic
1006001249 6:30966846-30966868 ATAGGGCTCTTCAGATATGCAGG - Intergenic
1006010519 6:31039176-31039198 ACAGAGCTTTTCAACGATGCTGG + Intergenic
1006062095 6:31431241-31431263 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1007213807 6:40220232-40220254 ACAGAGCTCTTTGAATATGCTGG - Intergenic
1008079607 6:47180278-47180300 ACAGACCTCTTCAAGGATGCAGG + Intergenic
1008400040 6:51053569-51053591 ACAGTGCTCTTCAAAGACGCAGG - Intergenic
1008636597 6:53417166-53417188 ACAGAACTTTTCAAGGATGCTGG - Intergenic
1009260412 6:61479326-61479348 ACAGGCGTCTTCCCAGATGCTGG - Intergenic
1009390358 6:63137001-63137023 ACAAGGCACTTCAAAGATGCAGG + Intergenic
1009787227 6:68355408-68355430 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1009806200 6:68604691-68604713 ACAGGGCTCTTCAAAAATGCAGG - Intergenic
1010323326 6:74538572-74538594 ATAAGGCTCTTCAAAGATGCAGG - Intergenic
1010407241 6:75519288-75519310 ACTGAGCTCTTCAAGGATGCTGG + Intergenic
1010552180 6:77236794-77236816 GCAGGACTCTTCAAAGATGCAGG - Intergenic
1010580975 6:77595659-77595681 AAAGGGCTCTTCAAAGATGCAGG + Intergenic
1010818342 6:80386168-80386190 ACAGGGCTTTTCAAAGGTGCAGG - Intergenic
1010818371 6:80386485-80386507 ACAGGGCTCTTCAAAGGTGCAGG - Intergenic
1011039605 6:83015175-83015197 ACGGGGCTCTTCAAAGATGAAGG + Intronic
1011068845 6:83359779-83359801 GCAAGGCTTTTCAAAGATGTAGG - Intronic
1011177051 6:84575304-84575326 ATAGGGCCTTTCAAGGATGCTGG - Intergenic
1012001680 6:93662544-93662566 ACAGAACTCTTCAAGGATGCTGG - Intergenic
1012225871 6:96702936-96702958 ACAGGGCTCTTCAAGGATGTTGG - Intergenic
1012344335 6:98168415-98168437 ACAGGGCTATTCAAAGATGCAGG - Intergenic
1012453227 6:99375689-99375711 CCAGGGATCTTGAAAAATGCTGG - Intronic
1012730220 6:102872400-102872422 ACAGGGCTCCTCAAAGATGCAGG - Intergenic
1012820551 6:104081007-104081029 ACAGGACTCTTCAAAGATTCAGG - Intergenic
1012921043 6:105221406-105221428 ACAGGGCTCTTAAAAAATGCAGG + Intergenic
1013589455 6:111608008-111608030 ACAGGCGTCTTCCCAGATGCTGG - Intergenic
1014416754 6:121193460-121193482 ACAGGGCTCTTCAAAGATTCAGG - Intronic
1014456088 6:121636476-121636498 ACAGGGCTCTTCAAAAATGCAGG + Intergenic
1014534453 6:122598542-122598564 ACAGGGCTCTTCAAAGATGCAGG + Intronic
1014538927 6:122650700-122650722 ACAGAGCTCTTTAAGGGTGCTGG + Intronic
1014631414 6:123794894-123794916 ATAGGGTTCTTCAATGATGCAGG - Intergenic
1014970011 6:127802295-127802317 ACAGGGCTCTTCAGAGATGCAGG - Intronic
1015467178 6:133560150-133560172 ACAAAGCTCTTCAAAGATGCAGG + Intergenic
1016055883 6:139577451-139577473 ACAGGGCTCTGCAAATGTGACGG - Intergenic
1016120153 6:140334569-140334591 AAAGAGCTCTTCAAGGATGCAGG + Intergenic
1016147547 6:140694635-140694657 ACAGGGCTCTTCAGAGATGCAGG + Intergenic
1016219952 6:141655701-141655723 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1016420236 6:143875215-143875237 ACAGGGATCTTCAGAGATGCAGG + Intronic
1016576498 6:145574513-145574535 ACAGGGTTCTTCAAAGATGCAGG + Intronic
1016886134 6:148961261-148961283 AAAGAGAGCTTCAAAGATGCAGG + Intronic
1017228073 6:152043006-152043028 ACAGAGCTCTTCAAGGATGCAGG + Intronic
1017442741 6:154478736-154478758 AAAGGACTTTTAAAAGATGCAGG - Intronic
1017451972 6:154562801-154562823 GCAGAGCTCTTCAAGGATGCTGG - Intergenic
1017989866 6:159476932-159476954 ACAGGGCTCTTCCAGGTTGCAGG - Intergenic
1018107584 6:160503720-160503742 ACAGGGCTCTTGAAAAATGCAGG + Intergenic
1018535253 6:164812395-164812417 ACAGAGCTCTTCAAAAACTCAGG + Intergenic
1018569711 6:165196152-165196174 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1018599626 6:165525602-165525624 ACAAGGCTCTTCAAAGATGCAGG - Intronic
1019087317 6:169490803-169490825 CCATGACTCTTCAGAGATGCAGG - Intronic
1019341966 7:512631-512653 CCAGGGCTTTCCAGAGATGCAGG + Intronic
1020242463 7:6406424-6406446 ACAGTTGTTTTCAAAGATGCAGG - Intergenic
1020396460 7:7723619-7723641 ATCGGGCTCTTGAAAGATACAGG - Intronic
1020567611 7:9817657-9817679 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1020710084 7:11595696-11595718 ACTGGACTTTTCAAAGATGCAGG - Intronic
1021794609 7:24241526-24241548 ACAGAGCTTTTCAAAGATAGGGG - Intergenic
1022014199 7:26335090-26335112 ACAGGGAACCTCAGAGATGCTGG + Intronic
1022990722 7:35704608-35704630 ACAGAGCTTTACAAAAATGCAGG - Intergenic
1023827677 7:44020395-44020417 ACAGGTGTCTTCCCAGATGCTGG - Intergenic
1024040129 7:45546612-45546634 ACAGGCCTCTTCAAAGATGCAGG + Intergenic
1024119987 7:46226837-46226859 CCAGTACTCTTCAAAAATGCAGG + Intergenic
1024783069 7:52874719-52874741 GTAGAGCTTTTCAAAGATGCTGG + Intergenic
1024884597 7:54126562-54126584 ACAGGGCTCTTCAAAGATATAGG + Intergenic
1024958504 7:54950997-54951019 ACAGAGCACTTCAAAGATGCAGG + Intergenic
1025761918 7:64403588-64403610 ACAGGGCTCTTCAAAGATGCGGG - Intergenic
1026280589 7:68918567-68918589 GCAGGGCCCTTCAAGGATCCAGG + Intergenic
1026731813 7:72918333-72918355 ACAGGCGTCTTCCCAGATGCTGG + Intronic
1027407011 7:77872674-77872696 ACAGGGCTCTTCAGAGATGCAGG + Intronic
1027615954 7:80424379-80424401 ACAGGACTCTTCAGAGAAACAGG - Intronic
1027685562 7:81276092-81276114 GCAAAGCTCTTCAAGGATGCAGG - Intergenic
1028043618 7:86089543-86089565 ACAGAGCTCTTCGATGATGCAGG - Intergenic
1028141493 7:87280058-87280080 GCAGGGCTCTTCAAAGATGCAGG - Intergenic
1029738854 7:102480163-102480185 ACAGGTGTCTTCCCAGATGCTGG - Intergenic
1029755980 7:102573819-102573841 ACAGGTGTCTTCCCAGATGCTGG - Intronic
1029773921 7:102672891-102672913 ACAGGTGTCTTCCCAGATGCTGG - Intergenic
1029960983 7:104689120-104689142 ACAGAACTCTTCAAGGATGCAGG - Intronic
1030277207 7:107734186-107734208 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1030368303 7:108671035-108671057 ACAAGGCTCTTCAAAGATGCAGG - Intergenic
1031236599 7:119186091-119186113 ACAGCACTCTTCAAGGATGCAGG - Intergenic
1031474693 7:122207257-122207279 ACAGAGCCCTTCAAAGATGCAGG + Intergenic
1031779372 7:125942161-125942183 ACAGAGCTTTTTAAGGATGCAGG + Intergenic
1032923672 7:136577715-136577737 GTAGGGCTTTTCAAAGATGCAGG + Intergenic
1033075961 7:138250785-138250807 ACAGAGCTCTTTAAAGATGCAGG - Intergenic
1034169740 7:149053785-149053807 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1034861513 7:154599111-154599133 ACATTGCTCTATAAAGATGCTGG - Intronic
1035275322 7:157744913-157744935 TCAGGGCCCCTCAGAGATGCCGG - Intronic
1036142131 8:6218289-6218311 AGGGAGCTCGTCAAAGATGCTGG - Intergenic
1037665564 8:20966763-20966785 ATAGAGCTTTTCAAAGAGGCTGG - Intergenic
1039292519 8:36111782-36111804 ACAGAGCCCCTCAAGGATGCTGG + Intergenic
1039330377 8:36530975-36530997 ACAGGGCCTTTCAAAGATGTTGG - Intergenic
1041543575 8:59014106-59014128 ATAGCACTCTTTAAAGATGCTGG - Intronic
1041803299 8:61822959-61822981 AGAGAGCTCTTCAAGGAGGCTGG + Intergenic
1041934232 8:63318948-63318970 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1041985934 8:63922563-63922585 ACAAGGCTCTTCAAAGATGCAGG - Intergenic
1042001310 8:64125886-64125908 ACAGGGCTCTTCAAAGATGTCGG + Intergenic
1043232707 8:77822849-77822871 ACGGAGCTCTTCAAAAATTCGGG + Intergenic
1043257756 8:78157444-78157466 ACTGGGCTCTTCAAAGATGCAGG - Intergenic
1043968355 8:86504460-86504482 ACAGGAATCTTCAAGGATGCAGG + Intronic
1044150553 8:88771146-88771168 ACAGAGCTCTTCAAAGATTCAGG - Intergenic
1044202148 8:89450566-89450588 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1044258048 8:90089192-90089214 GCAGTGTTCTTCAACGATGCTGG - Intronic
1044286218 8:90414371-90414393 ACAGAGCTCTTCAAGGAGGCAGG + Intergenic
1044487410 8:92769048-92769070 ACGGGGCTCTTCGAAGATGTAGG + Intergenic
1044599051 8:93985539-93985561 ACAGGGCTGTCCCATGATGCAGG - Intergenic
1044633670 8:94301705-94301727 ACAGGGCTCTACAAAGATGCAGG + Intergenic
1045221521 8:100204762-100204784 ACACGGCTCTTCAAAGATGCAGG - Intronic
1045377539 8:101590084-101590106 ACAGGGCTCTCAAAAAATGGTGG + Intronic
1046417901 8:113939729-113939751 ACAGGGTTCTTCAAAGATGCAGG + Intergenic
1046586025 8:116149557-116149579 ATGGGGCTCTACAAAGATGCAGG + Intergenic
1048654598 8:136522148-136522170 ACTGAGCTCTTCAAAGATACAGG + Intergenic
1049360171 8:142208918-142208940 AGAAGGCTCTTGAAAGATGCCGG + Intergenic
1050482411 9:6100691-6100713 ACAGGGTTCTTTAAAGATGTAGG - Intergenic
1050487353 9:6148222-6148244 ACAAAGCCCTTCACAGATGCTGG + Intergenic
1051966164 9:22832317-22832339 ACAGGGTTCTTTAAAGATGCAGG - Intergenic
1052227361 9:26106464-26106486 ACAGAGCTTTTTGAAGATGCAGG - Intronic
1052368390 9:27638915-27638937 ACAGGGCTCTTCAAATATGCAGG - Intergenic
1052577048 9:30304069-30304091 GCAGAGCTCTTCAAGGATACTGG - Intergenic
1052718551 9:32147202-32147224 ACAGAGCTCTTCAAAGATGCAGG - Intergenic
1053696032 9:40640077-40640099 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1054307279 9:63439295-63439317 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1054406010 9:64763287-64763309 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1054439636 9:65248774-65248796 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1054490771 9:65773165-65773187 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1055223260 9:73964504-73964526 ACAGAGCTCTTCAAGAATGCTGG - Intergenic
1056314489 9:85374869-85374891 ACAGGGCTCTTCAAAAATGCAGG + Intergenic
1057005077 9:91550034-91550056 AAGGGGCTCCTCAAGGATGCTGG + Intergenic
1057149264 9:92781914-92781936 ACACAGGTTTTCAAAGATGCCGG - Intergenic
1057236912 9:93368401-93368423 ACAGAGCTCTTCAAGAATGCTGG + Intergenic
1057316668 9:93973509-93973531 AAAGGGCTCTTCAAAGGTGCAGG - Intergenic
1057697945 9:97340699-97340721 ACAGGCGTCTTCCCAGATGCTGG - Intronic
1058259495 9:102811592-102811614 ACAGGGCTCTTCAAACATGTAGG + Intergenic
1058717807 9:107738293-107738315 AGAGGGCTGATCAGAGATGCTGG + Intergenic
1059714665 9:116902911-116902933 ACTGGGCTCTTCAAAGACATGGG - Intronic
1062557177 9:137118885-137118907 ACAGGTGTCTTCCCAGATGCTGG - Intergenic
1202778479 9_KI270717v1_random:13690-13712 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1203585557 Un_KI270747v1:89-111 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1186470030 X:9814004-9814026 ACAGGGCTCTTCAAAGATGCAGG + Intronic
1186770321 X:12811799-12811821 ACAAGGCTCTTCTAAGAATCAGG - Intronic
1188128263 X:26398352-26398374 AGAGGGCCCTTGAAAGATACTGG + Intergenic
1189531111 X:41884057-41884079 ACAGAGTTCTTCAAGGATGCTGG + Intronic
1189608825 X:42709534-42709556 ACAGAGATATTTAAAGATGCTGG + Intergenic
1189629909 X:42942081-42942103 ACAAAGCTCATCAAGGATGCTGG + Intergenic
1190538141 X:51449298-51449320 ACAGAGTTCTTCAAAGATGCTGG - Intergenic
1190988343 X:55521225-55521247 ACAGGGAGCCTCGAAGATGCTGG + Intergenic
1191095976 X:56673345-56673367 ACAGAGCTTTTGAAGGATGCAGG + Intergenic
1191113410 X:56826661-56826683 ATGGAGCTCTTCAAGGATGCTGG + Intergenic
1191134191 X:57045870-57045892 ACAGAGCTCTTCAAGGATGCAGG + Intergenic
1191226499 X:58049761-58049783 ACAGAGGTCTTCAAGGATGCAGG - Intergenic
1191587997 X:62849851-62849873 ACAGAGCTCTTCAAGGTTGCTGG - Intergenic
1191630348 X:63315131-63315153 ACAGGTCTCTTCAAAGATACAGG + Intergenic
1191719495 X:64217578-64217600 ACAGAGCTCTTCAAGGATGCAGG + Intergenic
1191742772 X:64453224-64453246 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1191769743 X:64742020-64742042 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1191773477 X:64786750-64786772 AGAGGGCTCTGCAAAGTTTCGGG - Intergenic
1192297964 X:69869910-69869932 ACAGGGCTATTCAAAGATGCAGG + Intronic
1192661809 X:73049681-73049703 ACAGAGCTCTTCAAGGATGCAGG + Intergenic
1192789592 X:74368305-74368327 ACAGAACTCTTCAAAGATGCAGG + Intergenic
1192995972 X:76513663-76513685 ACAGAGCTCTTCAAGGTTGCAGG - Intergenic
1193155886 X:78173946-78173968 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1193231663 X:79053957-79053979 ACAGATCTCTTTAAGGATGCTGG + Intergenic
1193297545 X:79850778-79850800 AAAGGGCTCTTCAAAGATGCAGG - Intergenic
1193433144 X:81437338-81437360 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1193446925 X:81616858-81616880 ACAGTGCTCTTCAAAGATGCAGG - Intergenic
1193573927 X:83176894-83176916 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1193877034 X:86873380-86873402 ACAGGGCTCTTCCAAGATGCAGG - Intergenic
1193904355 X:87224641-87224663 ACAGGGCTCTTCAAAAATGCAGG - Intergenic
1193979003 X:88158273-88158295 ACAGAGATCTTCAAGGATGCAGG - Intergenic
1194179836 X:90697876-90697898 ACAGAGCTCTTCAAAGATGCAGG + Intergenic
1194210034 X:91060442-91060464 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1194343071 X:92729188-92729210 ACAGAGCTCTTCAAGGATGCAGG - Intergenic
1194443320 X:93959178-93959200 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1194604637 X:95963902-95963924 ACAAGGCTCTTCAAAGATGCAGG + Intergenic
1194833693 X:98656874-98656896 ACAGGGCTCTTCGAAGATGCAGG - Intergenic
1194849508 X:98854092-98854114 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1195014118 X:100761738-100761760 ACAGAGCTTTTCAAGGATGTTGG + Intergenic
1195256626 X:103097093-103097115 ACAGGCCACTTCCAAGATGGTGG - Intergenic
1195809909 X:108817749-108817771 ACAGGGCTCTTCAAAGATAAAGG + Intergenic
1196275575 X:113762187-113762209 ACAGCGCTCTTCAAAAATGCAGG - Intergenic
1196485087 X:116197079-116197101 ACAGAGCTCATCAAAATTGCTGG - Intergenic
1197044208 X:121976523-121976545 ACAGAGCTCTTCAAGGATGCAGG - Intergenic
1197097223 X:122610918-122610940 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1197245358 X:124161235-124161257 ACAGGGCTCTTCAAAGATGCAGG + Intronic
1197380240 X:125729856-125729878 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1197387059 X:125814595-125814617 ACAGGGCTCTTCAAATACACAGG + Intergenic
1197404838 X:126037259-126037281 ACAGGGATCTTCAAAGATGCAGG - Intergenic
1197409460 X:126097755-126097777 ACATTGCTCTTCAAAGATGCAGG + Intergenic
1197554510 X:127937466-127937488 CTAGAGCTCTTCAAGGATGCAGG + Intergenic
1197591611 X:128417420-128417442 ACATGGCTCTTCAAAGATGCAGG - Intergenic
1198169787 X:134094343-134094365 ACAGAGCACTTCAAGGATCCTGG - Intergenic
1198701039 X:139398367-139398389 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1198783293 X:140259723-140259745 ACAGGGCTCTTCATAGATGCAGG + Intergenic
1198933762 X:141885928-141885950 GCAGATCTCTTCAAAGATGCAGG - Intronic
1198998704 X:142606840-142606862 ACAGGCGTCTTCCCAGATGCTGG + Intergenic
1199024138 X:142917793-142917815 ACAGGGCTCTTCAAAGATGCAGG - Intergenic
1199268737 X:145858203-145858225 GCAGGCCTCTTCCAAGATGGTGG + Intergenic
1199310657 X:146316186-146316208 ACGGGGCTCTTCAAAGATGCAGG + Intergenic
1199627330 X:149752517-149752539 ACAAGTCTCTTCAAAGATGTAGG + Intergenic
1199952747 X:152718160-152718182 ACTGCTCTCTTCAAAGAGGCAGG - Exonic
1199956936 X:152750288-152750310 ACTGCTCTCTTCAAAGAGGCAGG + Intronic
1200155858 X:153974614-153974636 CCAGGGCTGCTCAAAGATGCTGG + Intronic
1200340546 X:155391009-155391031 ACAGGACTCTTCAAAGATACAGG + Intergenic
1200526492 Y:4280045-4280067 ACAGAGCTCTTCAAAGATGCAGG + Intergenic
1200651431 Y:5845854-5845876 ACAGAGCTCTTCAAGGATGCAGG - Intergenic
1200976477 Y:9217001-9217023 ACAGGCCTCTTCAAAGATGCAGG - Intergenic
1201193791 Y:11471989-11472011 ACAGGGCTCTTCAAAGATGCAGG + Intergenic
1201529875 Y:14979934-14979956 ACAGGGCTCTTAAAAGATGCCGG + Intergenic
1201798211 Y:17924782-17924804 ACAGAGCTGTTCAAAGATGCGGG - Intergenic
1201803342 Y:17981175-17981197 ACAGAGCTGTTCAAAGATGCGGG + Intergenic
1202100193 Y:21299505-21299527 ATAGGGCTCTTCAAAGATACAGG - Intergenic
1202134693 Y:21649530-21649552 ACAGGCCTCTTCAAAGATGCAGG + Intergenic
1202341310 Y:23871794-23871816 ACAGGGCTATTCAAAAATGCAGG + Intergenic
1202359536 Y:24093473-24093495 ACAGAGCTGTTCAAAGATGCAGG - Intergenic
1202511242 Y:25576641-25576663 ACAGAGCTGTTCAAAGATGCAGG + Intergenic
1202529456 Y:25798292-25798314 ACAGGGCTATTCAAAAATGCAGG - Intergenic