ID: 1116058661

View in Genome Browser
Species Human (GRCh38)
Location 14:39895046-39895068
Sequence TACAGAGAAGAGCAATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 106, 1: 118, 2: 109, 3: 71, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116058661_1116058666 -5 Left 1116058661 14:39895046-39895068 CCCTGTAATTGCTCTTCTCTGTA 0: 106
1: 118
2: 109
3: 71
4: 297
Right 1116058666 14:39895064-39895086 CTGTATGTTGGATCTAAGGTGGG No data
1116058661_1116058665 -6 Left 1116058661 14:39895046-39895068 CCCTGTAATTGCTCTTCTCTGTA 0: 106
1: 118
2: 109
3: 71
4: 297
Right 1116058665 14:39895063-39895085 TCTGTATGTTGGATCTAAGGTGG No data
1116058661_1116058664 -9 Left 1116058661 14:39895046-39895068 CCCTGTAATTGCTCTTCTCTGTA 0: 106
1: 118
2: 109
3: 71
4: 297
Right 1116058664 14:39895060-39895082 TTCTCTGTATGTTGGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116058661 Original CRISPR TACAGAGAAGAGCAATTACA GGG (reversed) Intergenic
901904317 1:12394553-12394575 TACAGAGAAAAGCAATTACAGGG + Intronic
904335667 1:29796095-29796117 TACAGAGAACAGCAATTACAGGG - Intergenic
905464963 1:38146222-38146244 TACAGAGAAGAGTAACTACAGGG - Intergenic
905927380 1:41761076-41761098 TACAGGGCAGAGAGATTACAGGG + Intronic
906867834 1:49441637-49441659 TACAGAGAAGAGAAATTATAGGG - Intronic
906879437 1:49574595-49574617 TACAGAGAAGAGCAATTACAGGG - Intronic
907597096 1:55730209-55730231 TACAGAGCAAAGCAATTACAGGG - Intergenic
907780090 1:57558960-57558982 TATGGAGAAGAGCAATTACAGGG - Intronic
907834239 1:58093902-58093924 TACAGAGCAGAGCAAGCAAAGGG - Intronic
908616490 1:65928594-65928616 TACAGAGAAGAGCAATTACAGGG + Intronic
909172848 1:72317337-72317359 TACAGATTAGAGCAATTACAGGG + Intergenic
909576658 1:77183977-77183999 TACAGAGAAGAGCAATAACAGGG - Intronic
909810755 1:79929683-79929705 TACAGAGAAAAGCAATTACGGGG - Intergenic
910150832 1:84142621-84142643 TACAGAAATGAGCTGTTACATGG + Intronic
910371330 1:86518754-86518776 TTCAGGGAAGAACTATTACAAGG + Intergenic
910587958 1:88899858-88899880 TACAGAGAAGAGCAATTACAGGG - Intergenic
910639221 1:89441842-89441864 GACAGAGAAGAGCAATTATGAGG + Intergenic
910790168 1:91042547-91042569 TACAGAGAAGAGCAATTACAGGG - Intergenic
910831403 1:91465588-91465610 TACAGAGAAGAGCAATGACAGGG + Intergenic
911250940 1:95575636-95575658 TACAGGGAAGAGGTAGTACAGGG - Intergenic
911394135 1:97285471-97285493 TACATCAAAGAGCAATTATAAGG - Intronic
911883327 1:103268600-103268622 TACAGAAAAGAGCAATTACAGGG - Intergenic
911980214 1:104557786-104557808 TACAAAAAGGAGCAATTACAGGG - Intergenic
911982136 1:104581152-104581174 TACAGAGAAGAACAATTACAGGG + Intergenic
912050917 1:105526822-105526844 TACAGAGAAGGGCAATTATAGGG + Intergenic
912066798 1:105755072-105755094 TACGGATAAATGCAATTACAGGG - Intergenic
912130154 1:106589927-106589949 TACAGAGAAGAGCAATTACAGGG + Intergenic
912733572 1:112130704-112130726 TACGGAGAAGACCAATTACAGGG + Intergenic
912944066 1:114070052-114070074 TACAGAGAAGAGCAATTACAGGG + Intergenic
915027139 1:152841647-152841669 TAAAAAGATGAGCAATTACAAGG - Intergenic
915450766 1:156003447-156003469 TACAGGGTGGAGCAGTTACAAGG + Intronic
915667919 1:157461529-157461551 TACAGAGAAGAGCAATTACAGGG + Intergenic
916106588 1:161437169-161437191 TATAGAGAAGAGTAATTACAGGG + Intergenic
916621905 1:166507430-166507452 TACAGAAAAGTGCAATTATCTGG + Intergenic
917000754 1:170355717-170355739 TACAGAGTAGATCAACTTCAAGG - Intergenic
917079641 1:171243965-171243987 TAGAGAGAAAAACAATTTCACGG + Intergenic
917217466 1:172692784-172692806 TACAGAGAAGAGCAATTACAGGG + Intergenic
917282985 1:173396888-173396910 TACAGAGAAGAGCAATCACAAGG - Intergenic
917462474 1:175244341-175244363 TACAGAGAAGAGCAATTATAGGG - Intergenic
918755967 1:188339668-188339690 TAGAGAGAAGAGTGATTACAGGG + Intergenic
918774265 1:188608881-188608903 TACATAGAAGGGCAATTACAGGG - Intergenic
918918464 1:190673713-190673735 TACAGAGAAGAGCAATTACAGGG + Intergenic
919170833 1:193952096-193952118 TACAGGGCAGAGCAGTTAGAAGG + Intergenic
919558017 1:199085517-199085539 CACAGAGAAGAGCAAATGGATGG + Intergenic
920197172 1:204236485-204236507 TGCAGAGAAGAGCAATTACAGGG - Intronic
920984062 1:210867484-210867506 TACTGTGAAAAGCAATTAGATGG + Intronic
921428391 1:215032516-215032538 TAGAGAGAAGAGAAATGATATGG - Intronic
921601982 1:217115576-217115598 TAGAGAGGACAGCAAGTACAGGG - Intronic
921662941 1:217829070-217829092 TACACAGAAGAGAAATTGCTGGG - Intronic
922395401 1:225195227-225195249 TACACAGAATAGCAAAGACATGG + Intronic
923253826 1:232201260-232201282 TACAGAGAAAAGCAATTACAGGG + Intergenic
923575804 1:235158025-235158047 AACAGAGACATGCAATTACATGG + Intronic
924847397 1:247787110-247787132 TACAGAGAAGAGCAAGTACAAGG + Intergenic
1064517901 10:16170112-16170134 TACAGAGAAGAGCAAATACAGGG + Intergenic
1065300989 10:24321148-24321170 TACAGAGAAGTGAAATTGCAGGG - Intronic
1065329424 10:24578969-24578991 GACTGAGAAAAACAATTACATGG - Intergenic
1065648993 10:27867425-27867447 TGCACAGAAGAGAAACTACACGG + Intronic
1066120744 10:32284215-32284237 TTCAGAGAAGAACATTTAAAGGG - Intronic
1066163889 10:32764746-32764768 TGTAGAGAAGAGCAACCACAGGG - Intronic
1066192393 10:33068163-33068185 TCCAGAGAAGAGGAAATAAAAGG - Intergenic
1066253371 10:33655329-33655351 CACAGAGAAGAAAAATTGCAAGG - Intergenic
1066321708 10:34309264-34309286 TAGAGAGAAGAGCAATGCCAGGG + Intronic
1066543480 10:36474589-36474611 TACAGAGAAGAGCAATTACAGGG - Intergenic
1066957556 10:42187524-42187546 TACAGAGAAGAGCCTTTACAGGG - Intergenic
1067125846 10:43514764-43514786 TACAGAGAAGAGCAATTAGAGGG + Intergenic
1067754604 10:48995596-48995618 TGCATAGGAGAGCAATTACGGGG + Intergenic
1068184604 10:53568817-53568839 TATAGAGAAGAGAAATAAAATGG + Intergenic
1068225597 10:54103479-54103501 TACAGAGAAGAGCAATTATAGGG + Intronic
1068265870 10:54648640-54648662 TACAGAGAAGAGTATTTCTAAGG + Intronic
1068446962 10:57136711-57136733 TACAGAGAAGAGCAATTACAGGG - Intergenic
1068612437 10:59075059-59075081 CAGAGAAAAGAGCAAGTACAAGG - Intergenic
1068837495 10:61570479-61570501 TACAGAGAAGAGCAATTACACGG + Intergenic
1068851356 10:61745409-61745431 CAAAGAGAAGAGCAAGGACAGGG - Intronic
1069192571 10:65508246-65508268 TACAGAGAAGAACAATTACAGGG + Intergenic
1069791113 10:71021617-71021639 ACAAGAGAAGAGCAATTATAGGG + Intergenic
1070083342 10:73210246-73210268 TACAGAGAAGAGGGATTTCATGG + Exonic
1070567830 10:77617185-77617207 TACAGTGAAGTGCATTTCCAAGG + Intronic
1070940908 10:80346285-80346307 TACTGAGAAGAGGAATTACTGGG + Intronic
1071267340 10:83975881-83975903 TAGAGAGAAGAGCAACTGCAAGG + Intergenic
1071378144 10:85031549-85031571 CACAAAAAAGAGCAATTACAGGG - Intergenic
1071943031 10:90609656-90609678 TATAGAGAAGAGCAACTACAGGG + Intergenic
1072209516 10:93233565-93233587 TACAGAGAAGAGAAATTATAGGG + Intergenic
1072332228 10:94364930-94364952 CACATAAAAGAGCAATTAAAGGG - Intergenic
1072360225 10:94652273-94652295 TACAGAGAATAGCAATTACAGGG - Intergenic
1073557087 10:104464027-104464049 TACATAGAAGAACAATTACAGGG - Intergenic
1073656900 10:105426116-105426138 TACAGAGAAGAGAAATTACAGGG + Intergenic
1074119354 10:110481877-110481899 TAGAGGGAAGAGCAAGTGCAAGG - Intergenic
1074350711 10:112734135-112734157 TACTGAGAAGGGCAGTGACATGG - Intronic
1076927663 10:133501107-133501129 TACAGAGAAAAGCAATTGCAAGG + Intergenic
1078822176 11:14893224-14893246 GAGAGGGAAGAGCAATGACATGG + Intergenic
1079051875 11:17167898-17167920 CAGAGAGAAGAGCAATTTAAAGG - Intronic
1079883170 11:25952226-25952248 TACAGACAATAGCAGTAACATGG - Intergenic
1080018508 11:27533254-27533276 TACAGAGAAGACTAATGGCACGG - Intergenic
1080134915 11:28843479-28843501 CAGAGAGAAAAGCAAGTACAAGG - Intergenic
1080454856 11:32408849-32408871 TACAGAGTACAGTATTTACACGG - Intronic
1080750875 11:35148954-35148976 TGCAGAGAACAGAAATTTCAAGG - Intronic
1080976608 11:37349974-37349996 TACAGAGATGAGCAATTACAGGG - Intergenic
1080982563 11:37425582-37425604 CACAGACAAAAGCAATTACCTGG + Intergenic
1081065708 11:38536776-38536798 TACCAAGAAGAACAATTACAGGG + Intergenic
1081072543 11:38629206-38629228 TACAGAGAAGAGCAATTACAGGG - Intergenic
1081110215 11:39126504-39126526 TACAGAGAAGAGCAATTACAGGG - Intergenic
1081384010 11:42449253-42449275 CAGAGAGAAGAGCAAATACAAGG - Intergenic
1081608789 11:44545958-44545980 TACAGAGAAGAGCAATTACAGGG - Intergenic
1082106211 11:48224517-48224539 TCTAGAGAAGAGAAATTCCATGG + Intergenic
1082671449 11:56041160-56041182 TATAGAGAAAAGCAATTACAGGG - Intergenic
1082913673 11:58406949-58406971 TAAAGGGAAGAGCATTAACACGG + Intergenic
1082999370 11:59277646-59277668 TACAGAGAAGAGCAATTACAGGG - Intergenic
1085685706 11:78620292-78620314 TACAGAGAAAAGCAATTACAGGG - Intergenic
1085747323 11:79126346-79126368 TACAGAGATGAGCAATTACAGGG - Intronic
1086278377 11:85158570-85158592 TACAGAGTAGAACAATTACAGGG - Intronic
1087373811 11:97318865-97318887 TACAGAGAAGAGCAATTACAGGG - Intergenic
1087410994 11:97790045-97790067 TACAGAGAAGAGCAATTACAGGG + Intergenic
1087785091 11:102345934-102345956 TACAGAGAAAAGAAATGCCATGG - Intergenic
1087837536 11:102889938-102889960 CTCAGAGCAGAGCAATTACAAGG + Intergenic
1088191928 11:107236396-107236418 CAGAGAGAAGAGCAATTATAGGG + Intergenic
1088264901 11:107979656-107979678 TATAGAGAAGAGCAATTACAGGG - Intergenic
1088407863 11:109500559-109500581 TACAGAGAAGAACAATTATAGGG + Intergenic
1088446174 11:109931100-109931122 TGCAGAGATGGGGAATTACATGG - Intergenic
1088467064 11:110151800-110151822 TACAAACAAGAGAAAATACATGG - Intronic
1089111081 11:116057139-116057161 TACAGAGAAGTGAAATTGCTGGG + Intergenic
1089611592 11:119672414-119672436 TACACAGAGGAGCAGTTTCATGG - Intronic
1091051486 11:132376849-132376871 TACAGAGAAGAGCAATTACAGGG - Intergenic
1091148487 11:133302509-133302531 TACAGAGAAGCGAAATGACCTGG + Intronic
1092093024 12:5819738-5819760 TACAGAGAAGAGTGATTATAGGG - Intronic
1092381035 12:7997300-7997322 TACAGAGAAGAGCAATTACAGGG - Intergenic
1093046263 12:14448667-14448689 TACCCAGAAGAGGAATTACTAGG + Intronic
1093049175 12:14486851-14486873 TACAGAGACGAGCAATTAGAGGG + Intronic
1093049912 12:14492852-14492874 TATAGAGTCGAGCAATTAGAGGG + Intronic
1093246812 12:16748721-16748743 TATAAGGAAAAGCAATTACATGG + Intergenic
1093436798 12:19144559-19144581 TACATAGGAGTGCAAATACAAGG + Intronic
1093483673 12:19630044-19630066 TACATAGCAGAGCAATTAAGAGG - Intronic
1093574126 12:20706828-20706850 CACAGAGAAGGGCAGTGACATGG - Intronic
1093761333 12:22914827-22914849 TACCCATAAGAGCAATTTCAGGG - Intergenic
1095537724 12:43271749-43271771 TACAAAGAAGAGCATTTTTAGGG + Intergenic
1095856473 12:46865561-46865583 TACAGAGAAGAGCAATTACAGGG + Intergenic
1097076613 12:56399598-56399620 TACACAGAAGAGCAATTACAGGG - Intergenic
1097441148 12:59610146-59610168 TATAGAAGAGAGAAATTACAGGG + Intronic
1097821645 12:64134096-64134118 TACAGAGAACAGCAATTACAGGG + Intronic
1097843614 12:64344656-64344678 TACAGAGAAGAGCAATTACAGGG + Intronic
1097991663 12:65841398-65841420 TACTGAGAAGAGGAAATAAAAGG + Intronic
1098530358 12:71534720-71534742 AAAAGAGAAGAGTAAGTACAAGG - Intronic
1098672796 12:73252355-73252377 TACAGAGAAGAGCAATTACAGGG - Intergenic
1098688525 12:73456817-73456839 AAGAGAGAAGAGAAATTACCTGG + Intergenic
1098715848 12:73827918-73827940 CAGAGAAAAGAGCAATTACAGGG - Intergenic
1098749592 12:74277599-74277621 TACAGAGAAGAGCAATTACAGGG - Intergenic
1098805203 12:75014185-75014207 TACAGAGAAGAGCAATTCAAGGG - Intergenic
1099184047 12:79498567-79498589 TACAGAGAAAAGCAAGTACAGGG + Intergenic
1099348798 12:81538654-81538676 TATAGAAAACAGCAAATACAAGG + Intronic
1099379909 12:81940642-81940664 TACAGATAAGAGCTATTACAAGG + Intergenic
1099401366 12:82206601-82206623 TACAGAGAAGAGCAATCCAGAGG + Intergenic
1099526137 12:83721252-83721274 TACAAGGAAGAGCAATTACAGGG - Intergenic
1099577847 12:84403551-84403573 CACAGAGAAGAGCAATTACAGGG - Intergenic
1099859644 12:88210516-88210538 TACAGAGAAGAGTAATTACAGGG + Intergenic
1100083070 12:90876337-90876359 TACAGAGAAGAGCAATCACAGGG - Intergenic
1100241417 12:92713585-92713607 TACAGAGAAGAGCAATTACAGGG + Intergenic
1100345598 12:93726936-93726958 TACAAAGAGGAGCAATTTCAAGG - Intronic
1101263869 12:103064212-103064234 TACAGAGAAGAGCAATTACAGGG - Intergenic
1101437985 12:104680326-104680348 CAGAGAGAAGAGCAAGTGCAAGG + Intronic
1101534930 12:105608000-105608022 TACAGAGAAGAGCAATTACAGGG + Intergenic
1101991979 12:109493505-109493527 TACAGAGAAGAAAAACTACAAGG - Intronic
1102611198 12:114113948-114113970 TACAGAGAAGAGCAGTTGCAGGG - Intergenic
1103035320 12:117651840-117651862 TACAGAGAAGAGCAATTACAGGG - Intronic
1103396265 12:120609554-120609576 TACAGAGAAGAGCAATCACAGGG - Intergenic
1104394751 12:128422981-128423003 AAAATAGAACAGCAATTACATGG + Intronic
1104953957 12:132454791-132454813 CACAGAGAAGAGCAAACTCAGGG - Intergenic
1107845697 13:44510426-44510448 TTCACAGAAGTGCAATTGCAGGG - Intronic
1107983822 13:45757861-45757883 TACAGAGAAGAACAATTACAGGG + Intergenic
1108492687 13:50997096-50997118 TTCTGAGAAGAGAAATTGCAAGG - Intergenic
1108904046 13:55448074-55448096 TACAGAGAAAATCAATTACAGGG - Intergenic
1108914541 13:55590790-55590812 TACAGAAAAGAGCAATTACAGGG + Intergenic
1109292974 13:60498253-60498275 TACAGAGAAGAGCAATTACAGGG - Intronic
1109426746 13:62174371-62174393 TTCAGAGAAAAGCAACTACAAGG - Intergenic
1109516030 13:63443408-63443430 TACAGAGAAGAGCTGTTACAGGG - Intergenic
1109582814 13:64364245-64364267 TACAGAGAAGATAAATTACAGGG - Intergenic
1110545353 13:76749595-76749617 TACAGACAGGAGCCATCACATGG + Intergenic
1110778335 13:79435575-79435597 TACAGAGAAGAGAATTTGCTGGG - Intergenic
1111016431 13:82387714-82387736 TACAGAGAACAGCAACTACAGGG + Intergenic
1111576000 13:90154660-90154682 TACAGAAAAGAGCTATTACAGGG + Intergenic
1112250177 13:97772116-97772138 TACAGAGAAGAGCAATTACAGGG + Intergenic
1112377410 13:98855903-98855925 TAGTGAGAAGAGCAATTCCCTGG - Exonic
1113017424 13:105843519-105843541 TTCAGAGAACAGAAATTACATGG + Intergenic
1113045776 13:106153097-106153119 TCCAAAGAAGAGCCATTGCAAGG + Intergenic
1113319965 13:109223570-109223592 TACAGAAAAGAGCAATTACAGGG + Intergenic
1113994685 14:16056431-16056453 AACAGAGAAGAGCAAAGCCACGG + Intergenic
1114205661 14:20569207-20569229 TGCAGAGAAGAGCAAGTACAGGG - Intergenic
1114758515 14:25285752-25285774 TACAGAGAAGAGCAATTATAGGG + Intergenic
1115851580 14:37594215-37594237 TACAGGGAAAACCAGTTACAGGG - Intronic
1116058661 14:39895046-39895068 TACAGAGAAGAGCAATTACAGGG - Intergenic
1117216579 14:53558212-53558234 TATAGAGAAAAGCAATTACAAGG - Intergenic
1117288536 14:54310389-54310411 TACATAAAAGGGCAATTAAAGGG - Intergenic
1117596524 14:57331784-57331806 TACAGAGAAGAGCAATTACAGGG + Intergenic
1117633871 14:57722491-57722513 TACAGAGAAGAGCAATTACAGGG - Intronic
1118150222 14:63180956-63180978 TACAAAGAACATTAATTACATGG - Intergenic
1118881012 14:69825911-69825933 TGCAGAGAAGAGCAATTACAGGG + Intergenic
1118950813 14:70434977-70434999 TACAGAGAAGAGCAATTACAGGG + Intergenic
1119107826 14:71940737-71940759 TACAGAGAATGGCAATTACAGGG + Intronic
1120082281 14:80229438-80229460 TATAAAGAAGAGCAATTATAGGG + Intronic
1120303484 14:82737792-82737814 TACTGACAATAGCAAATACATGG - Intergenic
1120681531 14:87486368-87486390 AACAGAGAAGATTAAGTACAGGG + Intergenic
1120812455 14:88818033-88818055 TACAGAGAGCATCTATTACATGG + Intergenic
1120973408 14:90228570-90228592 TACAGAGAAGAGCAATTACAGGG - Intergenic
1121135585 14:91495059-91495081 TACCGAGAAGGGAAATTGCAAGG - Intronic
1121371124 14:93359398-93359420 TACGGAGAAGAGCAATTACAGGG - Intronic
1122021036 14:98838142-98838164 TACCGAGAAGTGGAATTGCAGGG - Intergenic
1122789413 14:104178106-104178128 GCCAGAGAAGGGCAAGTACAGGG - Intronic
1202935544 14_KI270725v1_random:84242-84264 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1123873167 15:24596769-24596791 TACAGAGAAGAGCAATCAGGAGG + Intergenic
1124926748 15:34077387-34077409 TTCAGAGATGAGCATTTAGAGGG - Intergenic
1125283386 15:38067429-38067451 GACAGAGAAAATCCATTACAAGG + Intergenic
1125539949 15:40464500-40464522 TACAGACCTGAGCACTTACAGGG + Exonic
1128043585 15:64597007-64597029 CACAGAGAAGAGAAAAAACAAGG - Intronic
1128321347 15:66696868-66696890 CACAGAGAACAGCAAGTGCAAGG - Intergenic
1129961646 15:79691952-79691974 TACAGAGAAAAGCAATTACAGGG + Intergenic
1130828512 15:87575007-87575029 TATAGAGAAGAAAATTTACATGG + Intergenic
1133638192 16:7690375-7690397 TACACTGAAGACCAATTAAATGG - Intronic
1134190343 16:12116181-12116203 TACCTAGAAGTGGAATTACAGGG - Intronic
1136452167 16:30359602-30359624 TGCTGAGAAGAGCAAGAACAAGG + Exonic
1137509286 16:49084341-49084363 TAGAGAGATCAGCAATAACAAGG - Intergenic
1138506022 16:57478689-57478711 TACAGAGAAGAGGTCTTACTGGG - Intronic
1138834301 16:60414740-60414762 AACAGAGAAGAGGAATTGAAAGG - Intergenic
1138868140 16:60848887-60848909 GACAGAGAAGAGTGATTACGGGG - Intergenic
1139078725 16:63487456-63487478 TTCTGTTAAGAGCAATTACAGGG + Intergenic
1139802060 16:69530781-69530803 AACAGAGAGGAGCAGTGACATGG + Intergenic
1140267395 16:73432624-73432646 TCCAGTGAACAGGAATTACATGG - Intergenic
1140597665 16:76435533-76435555 TACAGGGAAGAGCAATTGTAGGG + Intronic
1140606751 16:76548459-76548481 TACATGTAAGAACAATTACAAGG - Intronic
1141001617 16:80313533-80313555 TACAGAGAGGAGTACATACATGG + Intergenic
1141294152 16:82751189-82751211 TACAGAGAAGGGCAGATTCATGG + Intronic
1141767852 16:86070545-86070567 TAATGAGAAAATCAATTACACGG - Intergenic
1143414953 17:6740136-6740158 TATAGAGAAGAAAACTTACAGGG - Intergenic
1144067088 17:11634333-11634355 TGCAGAGAAGAACATTTTCAAGG + Intronic
1144077116 17:11729348-11729370 AACAGAGCAAAGCAATCACAAGG + Intronic
1144385178 17:14742742-14742764 TAGAGAGAAGAACAACTACAGGG + Intergenic
1144730369 17:17522503-17522525 TCCAAAGAAGAAGAATTACACGG + Intronic
1146850675 17:36219131-36219153 TACAGAGAAGAGCAATCACAGGG - Intronic
1147014428 17:37479723-37479745 CACAGAGAAGAGTCATTACATGG - Exonic
1147470679 17:40657263-40657285 AACAAAGAAGAGTAATTACTGGG + Intronic
1148535205 17:48432848-48432870 TGCAAAGAAGTGCAATTACCTGG - Intergenic
1149823480 17:59803198-59803220 GAGAGAGAAGAGAAACTACAAGG - Intronic
1150915656 17:69434161-69434183 TACAGAGAAGAGAGTTTGCATGG + Intronic
1151037865 17:70822106-70822128 TACAGAGAAGAGCAATTACGGGG + Intergenic
1151151661 17:72093297-72093319 TTCAGGGAAGAGCAATGTCAAGG + Intergenic
1153052920 18:917205-917227 TTCAGAGAAGAGCAGTTCTAAGG - Intergenic
1153193045 18:2563861-2563883 TAAAGGGTAGATCAATTACAGGG + Intronic
1153217956 18:2837504-2837526 TACAGAGAAGAGCAATTATAGGG + Intergenic
1154252994 18:12759493-12759515 TACAGAGAAGAGCAATTACAGGG + Intergenic
1154929952 18:20983149-20983171 TACAGAGAAAAGCAGTCATAGGG + Intronic
1155773709 18:29732129-29732151 AAAAGAGTAGAGCATTTACAAGG + Intergenic
1155910882 18:31503391-31503413 TAGAGAGAAGAGCATCTAAAAGG + Intronic
1155979401 18:32165011-32165033 AACAGAGAAGAGAAGGTACAAGG - Intronic
1156537540 18:37878630-37878652 TACACAGAAGAGCAATTATAGGG - Intergenic
1156765366 18:40647429-40647451 TACTGAAAAGAGAAATTAAAGGG - Intergenic
1156990535 18:43402596-43402618 TACAGAGAAGAACAATTACAGGG + Intergenic
1156998349 18:43495822-43495844 TACAGTGAAGAGGAATTACAGGG - Intergenic
1157283521 18:46361600-46361622 TACTGAGAAGAACATTAACAAGG - Intronic
1159287536 18:66373572-66373594 TAGAAATAAGAGCAATTTCAGGG - Intergenic
1159298995 18:66537891-66537913 TACAGACAGAAGGAATTACATGG - Intronic
1159559333 18:69977061-69977083 TACAGAGAAGAGCAATTTCAGGG + Intergenic
1159626589 18:70702276-70702298 TACAGTGAAGTGCAATTACATGG - Intergenic
1161538918 19:4837749-4837771 TACAGAGAAGGGGAACTTCAGGG - Intergenic
1163228104 19:15979238-15979260 TACAGAGGAAAGCAACTAGAAGG + Intergenic
1164097373 19:22023559-22023581 TGCAGAGAAGAGCAATTATAAGG + Intergenic
1164117559 19:22237008-22237030 TGCAGAGAAAAGTAATTACAAGG + Intergenic
1164200266 19:23012288-23012310 TGCAAAGAAGAGCAATTACAGGG + Intergenic
1165216979 19:34281917-34281939 TATAGAGAAGAACAAAGACAAGG - Intronic
925151165 2:1616056-1616078 TATAGAGAAGAGCATTTCCTAGG - Intergenic
925460475 2:4058578-4058600 TACAGAGAAGAACAATTACAGGG - Intergenic
925499644 2:4488806-4488828 TACAGAGAAGAGCAATTACAGGG + Intergenic
925914042 2:8591971-8591993 TAAGGAGAAGAGTAATTATAAGG - Intergenic
926352164 2:12005741-12005763 TACAGAGAAGTGCAATTTGGTGG + Intergenic
926810640 2:16752578-16752600 TATACAGAAGAGCAATTACAGGG + Intergenic
926825836 2:16904252-16904274 TACAAAGAAGAGCAATTACAGGG + Intergenic
927269832 2:21194394-21194416 AGCAGAGAAGAGGAAATACATGG - Intergenic
927279855 2:21295177-21295199 TACAGAGATGAGAAACAACAAGG + Intergenic
928551239 2:32372961-32372983 TACACAGAAGTGGGATTACAGGG + Intronic
930157638 2:48122008-48122030 TACCCAGAGGTGCAATTACAAGG - Intergenic
930456513 2:51613664-51613686 TACAGAGAAGAACAATTACAGGG + Intergenic
930909909 2:56618964-56618986 TACAGAGAAGAGTAATTACAGGG - Intergenic
931059931 2:58516208-58516230 TAGAGAGAAGAGCAAAGGCAGGG - Intergenic
931335480 2:61337836-61337858 TACTTAGAAGAGGAATTACTGGG + Intronic
931804804 2:65793952-65793974 AAAAGAGATGAGCAATTACAAGG - Intergenic
933435146 2:82239950-82239972 TGCAGACAAGAGCAAGTACACGG - Intergenic
934305668 2:91820038-91820060 TACAGAGAAGAGCCTTTACAGGG - Intergenic
934327588 2:92032704-92032726 TACAGAGAAGAGCCTTTACAGGG + Intergenic
934465975 2:94263283-94263305 TACAGAGAAGAGCCTTTACAGGG + Intergenic
935425347 2:102913222-102913244 TACAAAGAGGAACAATTACAAGG + Intergenic
935564566 2:104592161-104592183 TACAGAGAAGAGCAATTACAGGG + Intergenic
935662342 2:105477929-105477951 TAGAGGGAAGAGCAATCAGAGGG - Intergenic
936286441 2:111184906-111184928 TACAGGCTAGAGCAATCACATGG + Intergenic
936418368 2:112340779-112340801 TACAGAGATGAGTAATAAGATGG + Intergenic
937544585 2:123001514-123001536 TACAGGAAAAAGCAATGACATGG - Intergenic
937956648 2:127425531-127425553 CACAGAGGAAAGGAATTACAGGG - Intronic
938048476 2:128144857-128144879 TTCAGAAAATGGCAATTACAAGG + Intronic
938847877 2:135230151-135230173 TACAGAGGAGAGAAAATAGAAGG + Intronic
939213573 2:139210017-139210039 CACAGAGAAGAGCAATTACAGGG - Intergenic
940041943 2:149370167-149370189 TGCTGAGAAGAGCAATTTAAAGG + Intronic
940472335 2:154115001-154115023 TATGGAGAAGAGCAATTACAGGG + Intronic
940621329 2:156117605-156117627 TCCAGAGAAAAGCAATTAGGGGG + Intergenic
941068134 2:160926295-160926317 AACAGAGGGGAGAAATTACAGGG - Intergenic
941667754 2:168259283-168259305 TACAGAGAAGAGCAATTACAGGG - Intergenic
942232725 2:173874830-173874852 TACAGTGAAAAGAAATCACAAGG + Intergenic
942539882 2:177004728-177004750 TACACAGAAGAGGAATTGCTGGG - Intergenic
943384268 2:187182772-187182794 TACAGAGAAGAGCAATTACAGGG + Intergenic
943517849 2:188909136-188909158 TACAGAGAAGAGCAATCACAGGG + Intergenic
944481596 2:200163079-200163101 TACAGAGAATATCAAATAAATGG - Intergenic
945726065 2:213473382-213473404 TACAGAGAAGAGCAATTACAGGG + Intronic
945903812 2:215568516-215568538 TACAGAGAAGAGCAGGGACAAGG - Intergenic
946528116 2:220541861-220541883 TACAGAAAATAGCAATTACAGGG + Intergenic
948248218 2:236504173-236504195 TTCACAGAAGTGAAATTACACGG + Intronic
1168906626 20:1409132-1409154 TACAAAGCAGAGCAATATCAAGG - Intergenic
1169544032 20:6632471-6632493 TTCAGATATGAGCAATCACAGGG - Intergenic
1169977903 20:11351486-11351508 AACAGAGAAAGGCAATTACAAGG - Intergenic
1170296929 20:14837503-14837525 TACAAAGAAACGCAATTACTGGG - Intronic
1170538236 20:17362921-17362943 GACAGAGATGGCCAATTACATGG - Intronic
1171296447 20:24021201-24021223 ATCTGAGAAGAGCAATTACAGGG - Intergenic
1173709387 20:45141140-45141162 TACAGAAAAGAGCAAATACAGGG + Intergenic
1174081850 20:47975598-47975620 TGCAGAGAATAGCATTTACCTGG - Intergenic
1174906548 20:54557830-54557852 TCCTGAGAAGAGCAATAAGAGGG - Intronic
1175254405 20:57630521-57630543 TAGAGAGAACAGCAATTTGATGG + Intergenic
1175364592 20:58443779-58443801 TACAGAAAAAAGCACTTAAAAGG - Intronic
1175506994 20:59493137-59493159 CACAGTGCAAAGCAATTACACGG + Intergenic
1176043243 20:63078482-63078504 GACAAAGAAGAGCAAAGACAAGG - Intergenic
1176224949 20:63991901-63991923 AACACCGAAGTGCAATTACATGG + Intronic
1176521109 21:7825256-7825278 TATAGAAAAGAGCAATTCCCAGG + Intronic
1176596969 21:8706478-8706500 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1176997907 21:15578330-15578352 TACAGAGAAGAGCAATTACAGGG - Intergenic
1177002871 21:15635441-15635463 TACAGAGAAGAGCAATTACAGGG + Intergenic
1177363486 21:20103955-20103977 TACAGAGAAAAGCAATTACAGGG - Intergenic
1177505858 21:22016417-22016439 TAGAGAGACGAGCAATTACAGGG + Intergenic
1177933938 21:27318818-27318840 TACAGAGAAGAGAAATTATAGGG + Intergenic
1177991310 21:28039054-28039076 TACAGAGAAGAGCAATTACAGGG + Intergenic
1178253452 21:31028421-31028443 TTCAGAGAAGAGAAAATCCAAGG + Intergenic
1178655129 21:34455268-34455290 TATAGAAAAGAGCAATTCCCAGG + Intergenic
1178764070 21:35432830-35432852 TACAGAAAAGAGCAATTACAGGG + Intronic
1179353262 21:40633437-40633459 TACTGAGAACAGCAATTTCTAGG - Intronic
1179353379 21:40634574-40634596 TACAGAGAACAGGAATTTCTAGG - Intronic
1180279892 22:10683920-10683942 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1180312407 22:11250978-11251000 AACAGAGAAGAGCAAAGCCATGG - Intergenic
1180587109 22:16902456-16902478 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1180591391 22:16940274-16940296 TACAGAGAAGAGCCATTATAGGG + Intergenic
1182207808 22:28646310-28646332 TGCAGAGAAGATAAAATACATGG + Intronic
1182254413 22:29027964-29027986 TCTAGAGAAGGGCAGTTACATGG - Intronic
1182965618 22:34518707-34518729 TACAGAGAAGAGCAATTACAGGG + Intergenic
1184603819 22:45560291-45560313 TACCAAGACGAGCAATTACAGGG + Intronic
1184721633 22:46317908-46317930 TCAAGAGAAGAGCAACTACCAGG - Intronic
949125909 3:445054-445076 TACAGAGAAGAGCAACCACAGGG + Intergenic
949170288 3:988476-988498 TACTGAGAAGAGCAATTACAGGG + Intergenic
949316443 3:2761252-2761274 TAAAGGGAATAGCAAGTACAAGG - Intronic
949417901 3:3833086-3833108 TACAGAGAAGAGCAATTACAGGG + Intronic
949445362 3:4129146-4129168 TGCAGAGAAGGGCAATTACAGGG - Intronic
949527059 3:4915421-4915443 TACAAAGAAAAGAAATCACAGGG - Intergenic
949638536 3:6010632-6010654 TACAGAGAAGAGCAATTACAGGG - Intergenic
949751107 3:7353688-7353710 TGCAGACAAGAGCAATCACAGGG - Intronic
951003328 3:17590605-17590627 TGTAGAGAAGAGCAATTATAGGG - Intronic
951122350 3:18943672-18943694 TACAGAGAAGAGCAATCACAGGG - Intergenic
951229633 3:20162228-20162250 CAGAGTGAAGAACAATTACAGGG + Intronic
951308277 3:21093582-21093604 AATGGAGAAGAGGAATTACAAGG + Intergenic
951384298 3:22025846-22025868 TACAGAGAAGAGCAATTACAGGG - Intronic
951549689 3:23864670-23864692 TACAGAAAACAGAAATTATAGGG - Intronic
951571310 3:24065993-24066015 TACAGGGAAGAGGAATCACAGGG + Intergenic
951971003 3:28443761-28443783 TACAGAGAAGAGCAATTACAGGG + Intronic
952371334 3:32725759-32725781 TACTTTGAAGAGCAATAACAAGG + Intronic
952841291 3:37648036-37648058 TACCCAGAAGAGGAATTGCAGGG + Intronic
954053867 3:48005801-48005823 TGCAGAGAAGAGCAATTACAGGG - Intronic
954511785 3:51131870-51131892 TACAGAAAAGAGCAGTTACAGGG + Intronic
954923557 3:54212946-54212968 TATAGAGAAGGGCAATTAGGAGG - Intronic
954944344 3:54406174-54406196 TACCCAGAAGAGCAATTTCTGGG - Intronic
955035336 3:55262196-55262218 TACAGAGAAGAGCAATTACAGGG - Intergenic
955748593 3:62165081-62165103 TCCAGAGAAGACCAAATAAACGG - Intronic
956509394 3:69978455-69978477 TACAGAGAAGAGCAATTACAAGG - Intergenic
957247785 3:77735230-77735252 TACAGAGAAAAGCCATTACAGGG + Intergenic
957354983 3:79070844-79070866 TACATAAAAGAGCAATTAAAAGG - Intronic
957584521 3:82116483-82116505 TTCAGAGGAGAGCTTTTACAGGG - Intergenic
957674848 3:83353578-83353600 TACAGAGAAAAGAAAGTAAATGG + Intergenic
957897876 3:86446931-86446953 TACAGAGAAGAGAAATTACAGGG - Intergenic
958067661 3:88564619-88564641 TACAGAGAAGAGCAAACACCTGG + Intergenic
958789089 3:98630485-98630507 TAAAGAAAAGAGCAATTACAGGG + Intergenic
958845774 3:99262424-99262446 TACAGAGAAGAGCAACTACAAGG + Intergenic
958872883 3:99581755-99581777 TACAAATAAGAGCAATTATTTGG - Intergenic
958934059 3:100238731-100238753 TACAGAGAAGAGCAATTACAGGG - Intergenic
959204041 3:103282749-103282771 CACAGAGAAGAGCAATCACAGGG + Intergenic
959377636 3:105605063-105605085 TTCAGAGAAAAGCAATTACAAGG + Intergenic
959409411 3:106001548-106001570 TACAGAGAACAGGCACTACAGGG - Intergenic
959746262 3:109779152-109779174 TACAGAGAAGAGCAGTTACAGGG + Intergenic
960051044 3:113239879-113239901 TACAGAAAAAAGAAATTGCAGGG + Intronic
960349319 3:116574093-116574115 TACAGAGAAGAGCAGTTACAGGG - Intronic
960494986 3:118362690-118362712 TACAGAAAAGAGCAATTACAGGG + Intergenic
960922569 3:122762312-122762334 TTGAGAGAAGAGCAATTGGAAGG - Intronic
962558762 3:136583837-136583859 TAGACAGAAGATCAATTATAAGG + Intronic
962988807 3:140560076-140560098 TGCAGGGAAGAGCAATTATCTGG + Intronic
963149020 3:142024500-142024522 TCCAGAGATGAGAAATTTCAAGG + Intronic
963355910 3:144208743-144208765 TACAGAGAAGAGCAATTACAGGG + Intergenic
963396662 3:144743105-144743127 TACAGAGAACAGAAAATACAAGG + Intergenic
963566667 3:146939097-146939119 TACAGAGAAGAGCAATTACAGGG - Intergenic
963699525 3:148607123-148607145 TACAGAGCAGAGCAAGGGCAAGG + Intergenic
964278565 3:155035859-155035881 TTCTGAGCAGAGCAATGACATGG + Intronic
964977448 3:162637682-162637704 TACAGAGAACAGCAATTTCTGGG + Intergenic
965191070 3:165530457-165530479 TACAGAGAAGAACAATTACAGGG + Intergenic
965227010 3:166002663-166002685 TACAGAGAAGGGCAATTACAGGG + Intergenic
965741911 3:171884453-171884475 TATAGAGAAGTGAAATTAGAAGG - Intronic
965967645 3:174513960-174513982 TACAGAGAAGAGGGCTGACAAGG - Intronic
966044565 3:175532816-175532838 TGCAGAGAAGAGCAATTACAGGG + Intronic
966445435 3:179996663-179996685 TACAGAGAAGAGCAATTACAGGG - Intronic
968906621 4:3455726-3455748 TACAGAGAAGAGCAATTACAGGG - Intergenic
969467984 4:7368923-7368945 CACAGAGAAGAGCACGTGCAAGG - Intronic
970089438 4:12388246-12388268 TATAAAGAAGAGCAATTACAGGG + Intergenic
970238194 4:13980269-13980291 TGCAGAGCAGAACAATTACAGGG - Intergenic
970677119 4:18463786-18463808 CACAGAGAAGAGCAACCGCAAGG + Intergenic
970920107 4:21384059-21384081 TAGAGGGAAGAACAAGTACAAGG - Intronic
971101261 4:23468323-23468345 TACAGAGAAAAGCAATTACAGGG + Intergenic
971524417 4:27598586-27598608 TACAAAGAATAGTAATAACAGGG + Intergenic
971719043 4:30220980-30221002 AGCAGAGAAGAGCTATTGCATGG + Intergenic
971979540 4:33734760-33734782 TACAGAGAAGAGTAATTTTAGGG + Intergenic
972095265 4:35340784-35340806 TATAGAGAAGAGCAATTACAGGG - Intergenic
972201533 4:36719045-36719067 TACCGAGAAGAGCAATTACCGGG + Intergenic
972817882 4:42664750-42664772 TACAGATAAGAACCATTCCATGG - Intergenic
972883217 4:43450050-43450072 TATAGAGAAGAGCAATTACAGGG + Intergenic
972977304 4:44652243-44652265 TACAGAGAAGGGCCAATTCAGGG - Intronic
973102698 4:46292874-46292896 TACAGAGAAGAGCAATTACAGGG - Intronic
973118195 4:46487145-46487167 TACAGAGAAGAGCAATTACAGGG - Intergenic
973572701 4:52256595-52256617 CACAGACAAAAGCAATTACAAGG + Intergenic
974262618 4:59544177-59544199 TACAGAGAAGAGCAATTACAGGG + Intergenic
974289351 4:59910865-59910887 TACAGAGAAGAACAATTACAGGG - Intergenic
974644860 4:64676673-64676695 GACAGAGAAAAGCAATTACAGGG + Intergenic
974666912 4:64974049-64974071 TGCAGATAAGAGCAAAGACATGG + Intergenic
974747159 4:66090824-66090846 TACAGAAAAGAACAATTACAGGG + Intergenic
975486811 4:74942855-74942877 AACAAAGAGGAGCCATTACAGGG - Intronic
975814639 4:78205125-78205147 AAAAGAGAAGAGCAGTTAAAAGG + Intronic
975982867 4:80179172-80179194 TATAGAGAAGAGCAATTACTGGG + Intergenic
976034433 4:80797662-80797684 TACAGAGAAGAGCAATTACAGGG + Intronic
976509254 4:85889048-85889070 TATACAGAATAGCAAATACATGG - Intronic
977430511 4:96926324-96926346 CACAGAGAAGAGCAATTGCAGGG - Intergenic
977626845 4:99197221-99197243 TACAGTGAAGAGCAATCACAGGG + Intergenic
977977401 4:103282490-103282512 TTCAGAGCAAAGAAATTACAAGG + Intergenic
978341904 4:107728163-107728185 TACAGAGAAGAGCAATTACAGGG + Intergenic
978667581 4:111204097-111204119 GACAAGGAAGAGCAGTTACAAGG - Intergenic
978897660 4:113908758-113908780 TACACAGAATAGAAATTAAAGGG + Intronic
978899324 4:113928741-113928763 TACAGAGAAGAGCAATTACAGGG + Intronic
978966607 4:114749042-114749064 TACAGAGAAGAGCAATTACAGGG - Intergenic
979017957 4:115458791-115458813 CATAGAGAAGAGCAATTACAGGG + Intergenic
979075473 4:116264502-116264524 TACAGAGAAGAGCAATTTCAGGG - Intergenic
980289442 4:130826650-130826672 TACAGACAATATCAACTACAAGG + Intergenic
980388161 4:132113009-132113031 CACAGAAAAGAGCAATTACAGGG + Intergenic
980406138 4:132355700-132355722 TACAGAGAAGAGCAATTATAGGG + Intergenic
980416398 4:132494774-132494796 TACAGACAAGAAAAATTAGAAGG + Intergenic
980497779 4:133607275-133607297 CACAGAGAAGAGCAATTACAGGG + Intergenic
980601917 4:135037572-135037594 TACAGAGAAAAACAATTGCAGGG - Intergenic
980628418 4:135405723-135405745 TGCAGAGAAGAGCAATTACAGGG - Intergenic
981462550 4:145029898-145029920 TACAGAGAAGAGCAATTATAGGG - Intronic
981834604 4:149040565-149040587 TACAGAGAAGAGCAATTACAGGG - Intergenic
981902753 4:149886157-149886179 CAAAGAGATGAGCAATTAGAGGG + Intergenic
982348377 4:154386344-154386366 CACAGAGAACACCAAGTACAAGG - Intronic
982526954 4:156490502-156490524 TACAGAGAAGACCAATTACAGGG - Intergenic
982847529 4:160272405-160272427 TATAGAGAAGGGCAATTTCAGGG - Intergenic
983002532 4:162435198-162435220 TACTGAGAAGAGTATTTACTAGG + Intergenic
984061316 4:174991706-174991728 TACAGAAAAGAGCAATTACAGGG + Intergenic
984764789 4:183391821-183391843 TACAGAGAAAAGGAAGTGCAAGG - Intergenic
986037285 5:3952340-3952362 TACAGAGAAGAGCAATTACAAGG + Intergenic
986086214 5:4452849-4452871 TACAGATAAATGCAATGACATGG + Intergenic
986702257 5:10422020-10422042 CAGAGAGAAGAGGAAATACACGG + Intronic
986955781 5:13148035-13148057 TACAAAGAAGAGCAATTACAGGG + Intergenic
986959589 5:13197302-13197324 TACAGAGAAGAGCAATTACAGGG - Intergenic
987152926 5:15059767-15059789 TACAGAGAAGAGCAATTACAAGG - Intergenic
987565574 5:19580531-19580553 TACAGAAAGGTGCTATTACATGG + Intronic
987578603 5:19760236-19760258 CACAGAGAAGAGCAATTGCAGGG + Intronic
987621579 5:20343006-20343028 TACAGAGAAAAGCAATTATAGGG - Intronic
987657370 5:20823543-20823565 ATAAGAGAAGAGCAATTACAGGG + Intergenic
987665835 5:20937853-20937875 GACAGACAAGAACAATTACCTGG - Intergenic
988080068 5:26403323-26403345 GACATAGAAGAGCAATTACAGGG + Intergenic
988161056 5:27518777-27518799 TACAGAGAAGAGCAATTACGGGG + Intergenic
988169433 5:27634717-27634739 TACAGAAAAAAGCAATTACAGGG + Intergenic
988188046 5:27892144-27892166 AACATAAAAGAGCAGTTACAAGG - Intergenic
988228538 5:28446249-28446271 TACAGAGAATAGCAATTACAGGG - Intergenic
988233531 5:28508980-28509002 TACAGAGAAGAGCAATTACAGGG + Intergenic
988561875 5:32288978-32289000 TACAGAGACAAGCAATTACAGGG - Intronic
988756857 5:34264314-34264336 GACAGACAAGAACAATTACCTGG + Intergenic
988766174 5:34380403-34380425 ATAAGAGAAGAGCAATTACAGGG - Intergenic
989045563 5:37270135-37270157 TACAGAGAAGAGGAATGACAGGG + Intergenic
989097576 5:37795419-37795441 TACAGAGAAGAACAATTACAGGG - Intergenic
989113810 5:37932150-37932172 TACAGAGGAAAACAATTACAGGG - Intergenic
989457900 5:41663673-41663695 TATAGAGAAGAGCAATTACAGGG + Intergenic
990060000 5:51635998-51636020 TACCCTGAAGTGCAATTACAGGG - Intergenic
990131571 5:52592672-52592694 CAATAAGAAGAGCAATTACAGGG - Intergenic
990297553 5:54418144-54418166 TGGAGAGAAGACCAATTAGAAGG + Intergenic
991014067 5:61912802-61912824 TACAGAGAACAGCAATTACAGGG + Intergenic
991033298 5:62104002-62104024 TACAGAGAAGAGCAATCACAGGG - Intergenic
991945894 5:71898238-71898260 TATAGAGAAAAGCAATTACAAGG - Intergenic
993064578 5:83081761-83081783 TGCAGAGAAGAGCAAACAAATGG - Intronic
993124764 5:83820017-83820039 TATAGAGAAGAACATTTACTTGG + Intergenic
993319590 5:86456693-86456715 TACAGAGAAGAGCAATGACAGGG - Intergenic
993403387 5:87481105-87481127 TACCAAGCAGAGCAATGACAGGG - Intergenic
993412826 5:87593716-87593738 TACAGAGAAGAGCAATTACAGGG + Intergenic
993791542 5:92217018-92217040 TACAGAGAAGAGCAATTAGAGGG - Intergenic
994155458 5:96498513-96498535 TACATGCAATAGCAATTACATGG - Intergenic
994356638 5:98800660-98800682 TATGGAGAAGAGCAGTGACAGGG + Intergenic
994836885 5:104866253-104866275 TACAGAGAAGAGCAATTATAGGG - Intergenic
994984667 5:106917626-106917648 TACAGAGAAGAGCAATTATAGGG + Intergenic
995269802 5:110207365-110207387 TACAGAGAAGAGCAACTACAGGG + Intergenic
995776542 5:115729578-115729600 CACAGAGAAGAGCAATTACAGGG + Intergenic
996201427 5:120679460-120679482 AACAGAGATGTGCAATTATAAGG + Intronic
996392987 5:122983332-122983354 AAAAGAGAAGAGAAATTATAAGG - Intronic
996825313 5:127675926-127675948 TACAGAGAAGAGAATTTACAGGG - Intergenic
996884361 5:128338572-128338594 CACAAATAAGAGCAATAACATGG + Intronic
997742323 5:136267536-136267558 TCAACAGAAGATCAATTACAGGG + Intronic
999251473 5:150184904-150184926 TACAGAGAAGGGCATCTCCAGGG + Intergenic
999900113 5:156077909-156077931 TTTAGAGAAGAGCATCTACAGGG + Intronic
1000416719 5:160992022-160992044 TAGAGAGAAGAGCAATTACAGGG - Intergenic
1000730537 5:164829060-164829082 TACAGAGAAGAGCAATTACAGGG - Intergenic
1003696148 6:8407999-8408021 TACAGAGAAGAGCAATTACAGGG + Intergenic
1003758354 6:9148145-9148167 TACAGAGAAGAGCAATTACAGGG - Intergenic
1004144630 6:13053644-13053666 TAAAGACAAGAGCCATTCCAAGG - Intronic
1004824548 6:19405132-19405154 TACGGAAAACAGCAATTACAGGG + Intergenic
1004957044 6:20739055-20739077 AACAGAGAAGAGTAAATAAAAGG - Intronic
1005622712 6:27634883-27634905 TACAGAGAAGAGCAATTATAGGG + Intergenic
1005900158 6:30210374-30210396 TGGAGAGAAGAGCATGTACAAGG - Intronic
1006001250 6:30966863-30966885 TACAGAGAAGAGCAATTATAGGG - Intergenic
1006062096 6:31431258-31431280 TGCAGAGAAGAGCAATTACAGGG - Intergenic
1006483317 6:34316682-34316704 CAGAGGGAACAGCAATTACAAGG + Intronic
1006954946 6:37860690-37860712 AACAGAGAAGAGTAAATATATGG - Intronic
1007266652 6:40601331-40601353 AACAGAGAAGAGCAGTAATAGGG - Intergenic
1008778260 6:55067791-55067813 TACCTAGAAGAGGAATTACTGGG + Intergenic
1009390357 6:63136984-63137006 CACAGAGGACAGAAATTACAAGG + Intergenic
1009787226 6:68355391-68355413 CACAGAGAAGAGCAATTACAGGG + Intergenic
1009806201 6:68604708-68604730 CACAGATAAAAGCAATTACAGGG - Intergenic
1010323327 6:74538589-74538611 TACACAGAGGAGCAAGTATAAGG - Intergenic
1010325571 6:74558495-74558517 TACAGAGAAGAGCAATTACAGGG + Intergenic
1010551875 6:77233320-77233342 TTTAGAGAATAGCAATTACACGG + Intergenic
1010580974 6:77595642-77595664 TACACAGAAGAGCAGTTAAAGGG + Intergenic
1010818344 6:80386185-80386207 TCTAGAGAAAAGCAATTACAGGG - Intergenic
1010818374 6:80386502-80386524 TCCAGAGAAGAGCAATTACAGGG - Intergenic
1010940973 6:81917342-81917364 GAAAGAGAGGAGAAATTACATGG - Intergenic
1011039604 6:83015158-83015180 TACAGAGAAGGGCAATTACGGGG + Intronic
1011068846 6:83359796-83359818 TGCAGAGGAGAGCAAGTGCAAGG - Intronic
1012225873 6:96702953-96702975 TACAGAGAAGAGCGATCACAGGG - Intergenic
1012344336 6:98168432-98168454 TACAGAGAAGAGAAATTACAGGG - Intergenic
1012438997 6:99244874-99244896 TACAGACAAGAGCAAGATCAGGG - Intergenic
1012730221 6:102872417-102872439 TACAGAGAGGAGCAATTACAGGG - Intergenic
1012921042 6:105221389-105221411 TACAGAGAAGAGCAATTACAGGG + Intergenic
1014416755 6:121193477-121193499 TACAGAGAAGAACAATTACAGGG - Intronic
1014456087 6:121636459-121636481 TACAGAGAAGAGCAATTACAGGG + Intergenic
1014534452 6:122598525-122598547 TACAGAGAAGAACAATTACAGGG + Intronic
1014597763 6:123366849-123366871 TATAGAGAAGAGCATTTAAAAGG + Intronic
1014631415 6:123794911-123794933 TACAGAGAAAAGCAATTATAGGG - Intergenic
1014970012 6:127802312-127802334 TACAGAAAAGCGCAATTACAGGG - Intronic
1016144041 6:140647496-140647518 TACAGAGTAGAGCAATTACAGGG - Intergenic
1016147546 6:140694618-140694640 TACAGACTACAGCAATTACAGGG + Intergenic
1016267559 6:142250178-142250200 TTCAGAGAAGATGAATTTCAAGG - Intergenic
1016420235 6:143875198-143875220 TACAGAGAAAGGCAATTACAGGG + Intronic
1016576497 6:145574496-145574518 TACAGAGAAGAGCAATTACAGGG + Intronic
1017127649 6:151080793-151080815 TACAGAGAAGACGACATACAGGG - Intronic
1017155283 6:151317283-151317305 AACAGAGAAGAGCAGTTGGAGGG - Intronic
1017977365 6:159369965-159369987 TACAGAGAAGGGCAATTACAGGG + Intergenic
1018107583 6:160503703-160503725 TACAGAGAAGAGCAATTACAGGG + Intergenic
1018497285 6:164361756-164361778 TGCAGAGAAGAGTGAATACAGGG - Intergenic
1018569712 6:165196169-165196191 TACAGAGAAAAGCAATTACAGGG - Intergenic
1018599627 6:165525619-165525641 TACAGAGAAGAGCAATTACAAGG - Intronic
1019705041 7:2493550-2493572 CACAGAGAAGAGGGAGTACAAGG - Intergenic
1019777419 7:2920489-2920511 TACACAGAAGTGGAATTACTTGG + Intronic
1020396461 7:7723636-7723658 TACAGAGAAGAGCAATTATCGGG - Intronic
1020567610 7:9817640-9817662 TACAGGGAAGAGCAATTACAGGG + Intergenic
1021208746 7:17817457-17817479 TAAAGAGAAGAGAAATGAAAAGG + Intronic
1022078640 7:26998428-26998450 TACAGAGAAGAGCAATTACAGGG - Intergenic
1023471182 7:40522041-40522063 TACAGAGAAGAGACATTAGAGGG + Intronic
1023970152 7:44984991-44985013 AACAGTGAAGAGGAATAACAGGG - Intergenic
1024884596 7:54126545-54126567 TACAGAGAAGAGCAATTACAGGG + Intergenic
1025761920 7:64403605-64403627 TACAGAGAAGAGCAATTACAGGG - Intergenic
1025783027 7:64618607-64618629 TACAGAGAAGATTAATGACATGG - Intergenic
1027407009 7:77872657-77872679 TACCTGAAAGAGCAATTACAGGG + Intronic
1027516801 7:79152107-79152129 TAAAGAGAAAAGGAATTATAGGG + Intronic
1027833306 7:83208317-83208339 TACATGCAATAGCAATTACATGG + Intergenic
1028141494 7:87280075-87280097 TACAGAGGAGAGCAATTGCAGGG - Intergenic
1028237575 7:88380946-88380968 TACAGAGAAGAGCAATTACAGGG - Intergenic
1028778617 7:94708117-94708139 TACACAGAAGAGCACTCAAAGGG + Intergenic
1029201158 7:98840152-98840174 TACAGAGAAGAGCAGACACAGGG + Intergenic
1030277208 7:107734203-107734225 TACAGAAAAGAGCAATTACAGGG - Intergenic
1030315118 7:108106427-108106449 AAAAAAGAAAAGCAATTACAAGG + Intronic
1030368304 7:108671052-108671074 TACAGAGAAGAGCAATTACAAGG - Intergenic
1030716358 7:112812329-112812351 TACACAGAAGAGAAATTATATGG + Intergenic
1030743721 7:113139928-113139950 TGCATAGAAGAACAATTCCATGG + Intergenic
1031676308 7:124616442-124616464 TACAGTGAAGAGCAATTATGGGG - Intergenic
1032730402 7:134636666-134636688 TAAAGTGAAGAGCAATAAAATGG + Intergenic
1032923671 7:136577698-136577720 TACAGAGAAGAGCAATTGTAGGG + Intergenic
1034033827 7:147799159-147799181 CTCAGGGAAGAGCAATTAGAAGG + Intronic
1034169741 7:149053802-149053824 TACAGAGAAGAGCAATTACAGGG - Intergenic
1036050766 8:5194190-5194212 TACAGAAAAAATTAATTACATGG + Intergenic
1036100860 8:5783158-5783180 TAAAGAGAAAATCAATTAAAAGG - Intergenic
1038509866 8:28122793-28122815 GAAAAAGAAGAGCAATTAAACGG - Intronic
1038713839 8:29974116-29974138 TCCTGAGTAGAACAATTACAGGG + Intergenic
1039003188 8:33004580-33004602 TACATACAAGAACAATTGCATGG + Intergenic
1039330378 8:36530992-36531014 TACAGAGAAGAGCAATTACAGGG - Intergenic
1040674960 8:49737637-49737659 AAGAGAGAAGAGAAATGACATGG + Intergenic
1040852443 8:51914881-51914903 TACACAGAAGTGCAATTGCTGGG + Intergenic
1040916395 8:52569739-52569761 TACAGAAAAGAGCAATTACAGGG + Intergenic
1041632885 8:60107965-60107987 TAGAGAGCAGAGCAATCATAGGG - Intergenic
1041934233 8:63318965-63318987 TACAGAGAAGAGCAATTACAGGG - Intergenic
1041985935 8:63922580-63922602 TACAGAGAAGAGTGATTACAAGG - Intergenic
1042001309 8:64125869-64125891 TGAAGGGAAGAGCAATTACAGGG + Intergenic
1042746031 8:72107008-72107030 TGCAGAGAAAAGCAGTTCCAGGG - Intronic
1043257757 8:78157461-78157483 TACAGAGAAGAGCAATTACTGGG - Intergenic
1043260212 8:78186053-78186075 TACAGAGAAGAGCAATTACTGGG + Intergenic
1044202149 8:89450583-89450605 TACAGAGAAGAGCAATTACAGGG - Intergenic
1044227451 8:89735957-89735979 TAGAGAGCTGAGCAAATACAGGG + Intergenic
1044487409 8:92769031-92769053 TACAGAGAAGAGCAATTACGGGG + Intergenic
1044633669 8:94301688-94301710 TACAGAGAAGAGTAATTACAGGG + Intergenic
1045221522 8:100204779-100204801 TACAGAGAAGAGCAATTACACGG - Intronic
1045233047 8:100324208-100324230 TACAGAGAAGATCATTTAAAAGG - Intronic
1046197322 8:110882343-110882365 TACGGAGAAGAGCAGTTACAGGG - Intergenic
1046384626 8:113493482-113493504 TACAGAGAACAGCAATCACAGGG - Intergenic
1046417900 8:113939712-113939734 ATCTGAAAAGAGCAATTACAGGG + Intergenic
1046970278 8:120215516-120215538 TGCAGAGAAGTGAAATTACCTGG + Intronic
1047617983 8:126579032-126579054 TGCAGAGAAAAGCAATGACAAGG - Intergenic
1048226337 8:132590077-132590099 TACAGAGCAGAGCAAAGACAGGG - Intronic
1050447298 9:5739034-5739056 TACAGAGAAGTGCAATTATAGGG + Intronic
1050482412 9:6100708-6100730 TACAGAGAAGAGCAATTACAGGG - Intergenic
1050997645 9:12240338-12240360 TCCAATGAAGAACAATTACATGG - Intergenic
1051881885 9:21848734-21848756 TACAGAGAAGAGCAATTACAGGG - Intronic
1051966165 9:22832334-22832356 TACAGAGAAGAGCAATTACAGGG - Intergenic
1052368391 9:27638932-27638954 TACGGAGAAGAGCAATTACAGGG - Intergenic
1052399862 9:27986834-27986856 TACAGAAAGGAGAAAGTACATGG + Intronic
1052512956 9:29445203-29445225 TACTGAGAAGAGAAATTGCCAGG - Intergenic
1053696030 9:40640060-40640082 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1054307277 9:63439278-63439300 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1054406008 9:64763270-64763292 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1054439634 9:65248757-65248779 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1054490773 9:65773182-65773204 TACAGAGAAGAGCCTTTACAGGG - Intergenic
1055111782 9:72566970-72566992 CAAAGAGAAGAGCAACTAAAGGG - Intronic
1055114404 9:72591439-72591461 TATGGAGAAGAATAATTACAAGG + Intronic
1055240293 9:74176525-74176547 TACAGAGAAGAGCAAGGAGGAGG - Intergenic
1055250697 9:74301604-74301626 TACAAATATGAGCAATTACATGG + Intergenic
1056314488 9:85374852-85374874 TACAGAGAAGAGCAATTACAGGG + Intergenic
1057065352 9:92044544-92044566 TACTGAGAGGAGCAAAGACATGG + Intronic
1057316670 9:93973526-93973548 TACAGAAAAGAGCAATTAAAGGG - Intergenic
1058259494 9:102811575-102811597 TACAGAGAAGAGCAATTACAGGG + Intergenic
1058538611 9:105989383-105989405 CACAGAGACGAGAAACTACATGG - Intergenic
1059036154 9:110755774-110755796 TAAGGAGAAGAGGATTTACAAGG + Intronic
1202778477 9_KI270717v1_random:13673-13695 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1203585555 Un_KI270747v1:72-94 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1186110268 X:6247801-6247823 TACAGAGCAGAAGAATTAAAGGG - Intergenic
1186470029 X:9813987-9814009 TACAGGGAAGAACAATTACAGGG + Intronic
1187996570 X:24933253-24933275 TAGAGAGGAGAACAATTATAGGG + Intronic
1188020815 X:25155301-25155323 TCCACAGAAAAGCAATGACAGGG + Intergenic
1189090513 X:38077657-38077679 TACAGAAAAAAAAAATTACAAGG + Intronic
1189759043 X:44302029-44302051 TACATAGAAGTGGAATTACTGGG + Intronic
1190441494 X:50479393-50479415 TCCAGAAAAGAAAAATTACAAGG - Intergenic
1190934668 X:54986633-54986655 TACATAGAAGATCAACAACAGGG + Intronic
1191659056 X:63631892-63631914 TACAGAGAAGAGCAATTATAGGG + Intergenic
1191742771 X:64453207-64453229 TACGGAGAAGAGCAATTACAGGG + Intergenic
1191749712 X:64528704-64528726 TCCAGTGAAGAGGAATTTCAGGG - Intergenic
1191759119 X:64628019-64628041 CACAGAGAAGAACAATTACAGGG - Intergenic
1191769742 X:64742003-64742025 TACAGAAAAGAGTAATTACAGGG + Intergenic
1191946120 X:66537106-66537128 TACAAAGAAGAGCAATTACAGGG - Intergenic
1192297963 X:69869893-69869915 TACAGAGAAGAGCAATTACAGGG + Intronic
1192578662 X:72262928-72262950 TTCAGAAAAGAGAAAGTACAAGG + Intronic
1192673456 X:73170043-73170065 TACAGAGAAGAGCAATTACAGGG + Intergenic
1193053179 X:77123282-77123304 TTCAGAGAAGAGTAATTAAAGGG - Intergenic
1193155885 X:78173929-78173951 TACAGAGAAAAGCAATTACAGGG + Intergenic
1193297546 X:79850795-79850817 TAAAGAGAAGAGCAGTTAAAGGG - Intergenic
1193433143 X:81437321-81437343 ATAAGAGAAGAGCAATTACAGGG + Intergenic
1193573926 X:83176877-83176899 TACAGAGAAGAGCAATTACAGGG + Intergenic
1193841649 X:86414512-86414534 TACAGAGAAGAGCAATTATAGGG + Intronic
1193904356 X:87224658-87224680 TACAGAGAGGAGCAATTACAGGG - Intergenic
1193963369 X:87952338-87952360 TGCAGAGAAGAGCAATGTCCTGG + Intergenic
1194032243 X:88831761-88831783 TACAGAGAAGAGCAATTACAGGG + Intergenic
1194210035 X:91060459-91060481 TACAGAGAAAAGCAATTACAGGG - Intergenic
1194443321 X:93959195-93959217 CACAAAGAAGAGCAACTACAGGG - Intergenic
1194513658 X:94824148-94824170 TACAGAAAAGAATAATTACAGGG + Intergenic
1194604636 X:95963885-95963907 TATGGAGAAGAGCAATTACAAGG + Intergenic
1194833694 X:98656891-98656913 TACAGAGAAGAGCAATTACAGGG - Intergenic
1194849507 X:98854075-98854097 TACAGAGAAGAGCAATTACAGGG + Intergenic
1195058941 X:101175261-101175283 AACAGAGTAAAGCAATAACATGG - Intergenic
1195744267 X:108098999-108099021 TGCCCAGGAGAGCAATTACAAGG + Intronic
1195782617 X:108481774-108481796 TACAGAGATGAGCAATTACAGGG + Intronic
1195809908 X:108817732-108817754 TGCAGGGAAGAGCAATTACAGGG + Intergenic
1196372577 X:114996007-114996029 TACAGAGAAGAGCAATTACAGGG + Intergenic
1197002044 X:121451047-121451069 TACACAGAAGAGCAATTACAGGG - Intergenic
1197097224 X:122610935-122610957 TACAGAGAAGAACAATTACAGGG - Intergenic
1197245357 X:124161218-124161240 TACAGAGAAGAGCAATTACAGGG + Intronic
1197380239 X:125729839-125729861 TACGGAGAAGAGCAATTACAGGG + Intergenic
1197387058 X:125814578-125814600 TACAGAGAAGAGCAATTACAGGG + Intergenic
1197404840 X:126037276-126037298 TAAAGAGAAGAACCATTACAGGG - Intergenic
1197477611 X:126943232-126943254 TACAGAGAAGAGAAATTACAGGG + Intergenic
1197514412 X:127407588-127407610 TACCGAGAAGAGGAATTTCTGGG + Intergenic
1197591612 X:128417437-128417459 TACAGAGAAGAGCAATTACATGG - Intergenic
1198701040 X:139398384-139398406 TACAGAGAAGAGCAATTACAGGG - Intergenic
1198783292 X:140259706-140259728 TACAGAGAAGAGCAATTACAGGG + Intergenic
1199024139 X:142917810-142917832 TACAGAGAAGAGCAATTACAGGG - Intergenic
1199310656 X:146316169-146316191 TACAGAGAAAAGCAATTACGGGG + Intergenic
1199399721 X:147383776-147383798 CACAGAAGAGAGCACTTACAGGG + Intergenic
1200973304 Y:9179453-9179475 TACACAGAAGAGAAATTACAGGG + Intergenic
1201193789 Y:11471972-11471994 TACAGAGAAGAGCCTTTACAGGG + Intergenic
1201361904 Y:13161180-13161202 TAGAGAGAACGCCAATTACATGG + Intergenic
1201529874 Y:14979917-14979939 CACAGAGAAAAGCAATTACAGGG + Intergenic
1201735090 Y:17251176-17251198 TACAGAGAAGCTCAATAAAATGG + Intergenic
1201796852 Y:17905426-17905448 TCCATAGAAGAGCAATTACAGGG + Intergenic
1201804701 Y:18000559-18000581 TCCATAGAAGAGCAATTACAGGG - Intergenic
1202100194 Y:21299522-21299544 TACAGAGAAGAGCAATTATAGGG - Intergenic
1202137773 Y:21685059-21685081 TACACAGAAGAGAAATTACAGGG - Intergenic
1202341309 Y:23871777-23871799 AAAAGAGAAGAGCAATTACAGGG + Intergenic
1202358230 Y:24074485-24074507 TCCAGAGAAGAGCAATTACAGGG + Intergenic
1202512548 Y:25595628-25595650 TCCAGAGAAGAGCAATTACAGGG - Intergenic
1202529457 Y:25798309-25798331 AAAAGAGAAGAGCAATTACAGGG - Intergenic