ID: 1116058664

View in Genome Browser
Species Human (GRCh38)
Location 14:39895060-39895082
Sequence TTCTCTGTATGTTGGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116058662_1116058664 -10 Left 1116058662 14:39895047-39895069 CCTGTAATTGCTCTTCTCTGTAT 0: 115
1: 128
2: 101
3: 87
4: 503
Right 1116058664 14:39895060-39895082 TTCTCTGTATGTTGGATCTAAGG No data
1116058660_1116058664 8 Left 1116058660 14:39895029-39895051 CCTGCATCTTTGAAGAGCCCTGT 0: 118
1: 138
2: 123
3: 118
4: 251
Right 1116058664 14:39895060-39895082 TTCTCTGTATGTTGGATCTAAGG No data
1116058661_1116058664 -9 Left 1116058661 14:39895046-39895068 CCCTGTAATTGCTCTTCTCTGTA 0: 106
1: 118
2: 109
3: 71
4: 297
Right 1116058664 14:39895060-39895082 TTCTCTGTATGTTGGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116058664 Original CRISPR TTCTCTGTATGTTGGATCTA AGG Intergenic
No off target data available for this crispr