ID: 1116058905

View in Genome Browser
Species Human (GRCh38)
Location 14:39896911-39896933
Sequence AGTTATCTGTAGAATATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116058905_1116058911 22 Left 1116058905 14:39896911-39896933 CCTGCCATATTCTACAGATAACT No data
Right 1116058911 14:39896956-39896978 CTTGGCCTGTTGCTGGGCTTTGG No data
1116058905_1116058910 16 Left 1116058905 14:39896911-39896933 CCTGCCATATTCTACAGATAACT No data
Right 1116058910 14:39896950-39896972 ACAGCTCTTGGCCTGTTGCTGGG No data
1116058905_1116058907 4 Left 1116058905 14:39896911-39896933 CCTGCCATATTCTACAGATAACT No data
Right 1116058907 14:39896938-39896960 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1116058905_1116058909 15 Left 1116058905 14:39896911-39896933 CCTGCCATATTCTACAGATAACT No data
Right 1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116058905 Original CRISPR AGTTATCTGTAGAATATGGC AGG (reversed) Intergenic
No off target data available for this crispr