ID: 1116058909

View in Genome Browser
Species Human (GRCh38)
Location 14:39896949-39896971
Sequence GACAGCTCTTGGCCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116058905_1116058909 15 Left 1116058905 14:39896911-39896933 CCTGCCATATTCTACAGATAACT No data
Right 1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG No data
1116058906_1116058909 11 Left 1116058906 14:39896915-39896937 CCATATTCTACAGATAACTACTG No data
Right 1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG No data
1116058904_1116058909 16 Left 1116058904 14:39896910-39896932 CCCTGCCATATTCTACAGATAAC No data
Right 1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116058909 Original CRISPR GACAGCTCTTGGCCTGTTGC TGG Intergenic
No off target data available for this crispr