ID: 1116060263

View in Genome Browser
Species Human (GRCh38)
Location 14:39915140-39915162
Sequence GCACCTAGAAAGTGAAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116060263_1116060266 -10 Left 1116060263 14:39915140-39915162 CCTAATTTTCACTTTCTAGGTGC No data
Right 1116060266 14:39915153-39915175 TTCTAGGTGCTGGCTCTGGATGG No data
1116060263_1116060267 -4 Left 1116060263 14:39915140-39915162 CCTAATTTTCACTTTCTAGGTGC No data
Right 1116060267 14:39915159-39915181 GTGCTGGCTCTGGATGGCTCAGG No data
1116060263_1116060268 20 Left 1116060263 14:39915140-39915162 CCTAATTTTCACTTTCTAGGTGC No data
Right 1116060268 14:39915183-39915205 AACAACTCTAATGTAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116060263 Original CRISPR GCACCTAGAAAGTGAAAATT AGG (reversed) Intergenic
No off target data available for this crispr