ID: 1116060497

View in Genome Browser
Species Human (GRCh38)
Location 14:39918584-39918606
Sequence CCTGAGTAGCTGTGATTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116060493_1116060497 -10 Left 1116060493 14:39918571-39918593 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 1116060497 14:39918584-39918606 CCTGAGTAGCTGTGATTATCCGG No data
1116060492_1116060497 7 Left 1116060492 14:39918554-39918576 CCAGTTCAAGTTATTCTCCTGCC 0: 8
1: 1283
2: 3943
3: 4263
4: 3099
Right 1116060497 14:39918584-39918606 CCTGAGTAGCTGTGATTATCCGG No data
1116060491_1116060497 8 Left 1116060491 14:39918553-39918575 CCCAGTTCAAGTTATTCTCCTGC 0: 23
1: 2969
2: 46440
3: 127164
4: 148236
Right 1116060497 14:39918584-39918606 CCTGAGTAGCTGTGATTATCCGG No data
1116060490_1116060497 17 Left 1116060490 14:39918544-39918566 CCTCTGTTTCCCAGTTCAAGTTA No data
Right 1116060497 14:39918584-39918606 CCTGAGTAGCTGTGATTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116060497 Original CRISPR CCTGAGTAGCTGTGATTATC CGG Intergenic
No off target data available for this crispr