ID: 1116065191

View in Genome Browser
Species Human (GRCh38)
Location 14:39973082-39973104
Sequence GAGGGTCCCACAAGCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116065183_1116065191 7 Left 1116065183 14:39973052-39973074 CCTGTGCATGTGGATTAACCAAT No data
Right 1116065191 14:39973082-39973104 GAGGGTCCCACAAGCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116065191 Original CRISPR GAGGGTCCCACAAGCCTGGG TGG Intergenic
No off target data available for this crispr