ID: 1116068091

View in Genome Browser
Species Human (GRCh38)
Location 14:40009144-40009166
Sequence AGTTATCTGAAGAAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116068091_1116068095 15 Left 1116068091 14:40009144-40009166 CCTCCCATCTTCTTCAGATAACT No data
Right 1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG No data
1116068091_1116068097 22 Left 1116068091 14:40009144-40009166 CCTCCCATCTTCTTCAGATAACT No data
Right 1116068097 14:40009189-40009211 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1116068091_1116068094 4 Left 1116068091 14:40009144-40009166 CCTCCCATCTTCTTCAGATAACT No data
Right 1116068094 14:40009171-40009193 TTATTCTGTGAAACAGCTCTTGG No data
1116068091_1116068096 16 Left 1116068091 14:40009144-40009166 CCTCCCATCTTCTTCAGATAACT No data
Right 1116068096 14:40009183-40009205 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116068091 Original CRISPR AGTTATCTGAAGAAGATGGG AGG (reversed) Intergenic
No off target data available for this crispr