ID: 1116068095

View in Genome Browser
Species Human (GRCh38)
Location 14:40009182-40009204
Sequence AACAGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116068090_1116068095 16 Left 1116068090 14:40009143-40009165 CCCTCCCATCTTCTTCAGATAAC No data
Right 1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG No data
1116068091_1116068095 15 Left 1116068091 14:40009144-40009166 CCTCCCATCTTCTTCAGATAACT No data
Right 1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG No data
1116068092_1116068095 12 Left 1116068092 14:40009147-40009169 CCCATCTTCTTCAGATAACTACT No data
Right 1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG No data
1116068093_1116068095 11 Left 1116068093 14:40009148-40009170 CCATCTTCTTCAGATAACTACTC 0: 8
1: 196
2: 189
3: 121
4: 302
Right 1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116068095 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr