ID: 1116069756

View in Genome Browser
Species Human (GRCh38)
Location 14:40028837-40028859
Sequence GTAAAGATAGAGATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116069756_1116069762 27 Left 1116069756 14:40028837-40028859 CCTCCCTCAATCTCTATCTTTAC No data
Right 1116069762 14:40028887-40028909 TTTCTAGTCTCATGTCTTTCTGG No data
1116069756_1116069759 -5 Left 1116069756 14:40028837-40028859 CCTCCCTCAATCTCTATCTTTAC No data
Right 1116069759 14:40028855-40028877 TTTACTTATCTGTGTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116069756 Original CRISPR GTAAAGATAGAGATTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr