ID: 1116073226

View in Genome Browser
Species Human (GRCh38)
Location 14:40075326-40075348
Sequence TGTCCTTTGTTTAGAACAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116073222_1116073226 1 Left 1116073222 14:40075302-40075324 CCCAGCCACTTGTTTGAACCTCT No data
Right 1116073226 14:40075326-40075348 TGTCCTTTGTTTAGAACAAGAGG No data
1116073220_1116073226 30 Left 1116073220 14:40075273-40075295 CCTTAGGAAAATTGCTGGTGATC No data
Right 1116073226 14:40075326-40075348 TGTCCTTTGTTTAGAACAAGAGG No data
1116073223_1116073226 0 Left 1116073223 14:40075303-40075325 CCAGCCACTTGTTTGAACCTCTC No data
Right 1116073226 14:40075326-40075348 TGTCCTTTGTTTAGAACAAGAGG No data
1116073221_1116073226 2 Left 1116073221 14:40075301-40075323 CCCCAGCCACTTGTTTGAACCTC No data
Right 1116073226 14:40075326-40075348 TGTCCTTTGTTTAGAACAAGAGG No data
1116073224_1116073226 -4 Left 1116073224 14:40075307-40075329 CCACTTGTTTGAACCTCTCTGTC No data
Right 1116073226 14:40075326-40075348 TGTCCTTTGTTTAGAACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116073226 Original CRISPR TGTCCTTTGTTTAGAACAAG AGG Intergenic
No off target data available for this crispr