ID: 1116077294

View in Genome Browser
Species Human (GRCh38)
Location 14:40127192-40127214
Sequence AGTCTGACAGAACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116077294_1116077296 5 Left 1116077294 14:40127192-40127214 CCAGCTTGTGGTTCTGTCAGACT No data
Right 1116077296 14:40127220-40127242 TGTGGTATCTGAAATTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116077294 Original CRISPR AGTCTGACAGAACCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr