ID: 1116077296

View in Genome Browser
Species Human (GRCh38)
Location 14:40127220-40127242
Sequence TGTGGTATCTGAAATTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116077291_1116077296 16 Left 1116077291 14:40127181-40127203 CCAACCTCCTTCCAGCTTGTGGT No data
Right 1116077296 14:40127220-40127242 TGTGGTATCTGAAATTGCTCTGG No data
1116077293_1116077296 9 Left 1116077293 14:40127188-40127210 CCTTCCAGCTTGTGGTTCTGTCA No data
Right 1116077296 14:40127220-40127242 TGTGGTATCTGAAATTGCTCTGG No data
1116077294_1116077296 5 Left 1116077294 14:40127192-40127214 CCAGCTTGTGGTTCTGTCAGACT No data
Right 1116077296 14:40127220-40127242 TGTGGTATCTGAAATTGCTCTGG No data
1116077289_1116077296 29 Left 1116077289 14:40127168-40127190 CCAATTCGGGGATCCAACCTCCT No data
Right 1116077296 14:40127220-40127242 TGTGGTATCTGAAATTGCTCTGG No data
1116077292_1116077296 12 Left 1116077292 14:40127185-40127207 CCTCCTTCCAGCTTGTGGTTCTG No data
Right 1116077296 14:40127220-40127242 TGTGGTATCTGAAATTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116077296 Original CRISPR TGTGGTATCTGAAATTGCTC TGG Intergenic
No off target data available for this crispr