ID: 1116079308

View in Genome Browser
Species Human (GRCh38)
Location 14:40153692-40153714
Sequence TAGCTGATACCCACCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116079303_1116079308 12 Left 1116079303 14:40153657-40153679 CCCTGTCACGGGGGAAGACAAAA No data
Right 1116079308 14:40153692-40153714 TAGCTGATACCCACCCATGGAGG No data
1116079304_1116079308 11 Left 1116079304 14:40153658-40153680 CCTGTCACGGGGGAAGACAAAAC No data
Right 1116079308 14:40153692-40153714 TAGCTGATACCCACCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116079308 Original CRISPR TAGCTGATACCCACCCATGG AGG Intergenic
No off target data available for this crispr