ID: 1116082799

View in Genome Browser
Species Human (GRCh38)
Location 14:40197840-40197862
Sequence CAGATGTTTTAGAGAACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116082799_1116082800 27 Left 1116082799 14:40197840-40197862 CCTTTAGTTCTCTAAAACATCTG No data
Right 1116082800 14:40197890-40197912 TTGTTGCTTTTGATGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116082799 Original CRISPR CAGATGTTTTAGAGAACTAA AGG (reversed) Intergenic
No off target data available for this crispr