ID: 1116082901

View in Genome Browser
Species Human (GRCh38)
Location 14:40199124-40199146
Sequence CCTGCATTGCTGGAGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116082901_1116082908 -7 Left 1116082901 14:40199124-40199146 CCCTAGACCTCCAGCAATGCAGG No data
Right 1116082908 14:40199140-40199162 ATGCAGGACATTTCCCAGGGTGG No data
1116082901_1116082907 -10 Left 1116082901 14:40199124-40199146 CCCTAGACCTCCAGCAATGCAGG No data
Right 1116082907 14:40199137-40199159 GCAATGCAGGACATTTCCCAGGG No data
1116082901_1116082909 -1 Left 1116082901 14:40199124-40199146 CCCTAGACCTCCAGCAATGCAGG No data
Right 1116082909 14:40199146-40199168 GACATTTCCCAGGGTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116082901 Original CRISPR CCTGCATTGCTGGAGGTCTA GGG (reversed) Intergenic
No off target data available for this crispr