ID: 1116083172

View in Genome Browser
Species Human (GRCh38)
Location 14:40202801-40202823
Sequence GGCAAGCATGAGAGCGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116083172_1116083184 29 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083184 14:40202853-40202875 GGTGCATGAGTGAGCAAACATGG No data
1116083172_1116083181 7 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083181 14:40202831-40202853 AGCCAGGTGCAGGGTGCTGAGGG No data
1116083172_1116083180 6 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083180 14:40202830-40202852 GAGCCAGGTGCAGGGTGCTGAGG No data
1116083172_1116083182 8 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083182 14:40202832-40202854 GCCAGGTGCAGGGTGCTGAGGGG No data
1116083172_1116083177 -3 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083177 14:40202821-40202843 GCCAAGGGCGAGCCAGGTGCAGG No data
1116083172_1116083185 30 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083185 14:40202854-40202876 GTGCATGAGTGAGCAAACATGGG No data
1116083172_1116083179 -2 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083179 14:40202822-40202844 CCAAGGGCGAGCCAGGTGCAGGG No data
1116083172_1116083176 -9 Left 1116083172 14:40202801-40202823 CCAGCCTCGCTCTCATGCTTGCC No data
Right 1116083176 14:40202815-40202837 ATGCTTGCCAAGGGCGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116083172 Original CRISPR GGCAAGCATGAGAGCGAGGC TGG (reversed) Intergenic