ID: 1116089281

View in Genome Browser
Species Human (GRCh38)
Location 14:40284477-40284499
Sequence CTACCTATCACACTTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116089281_1116089283 15 Left 1116089281 14:40284477-40284499 CCAAACACAAGTGTGATAGGTAG No data
Right 1116089283 14:40284515-40284537 GCAGTAGTCCCCAACATTTTTGG 0: 3
1: 41
2: 557
3: 1400
4: 1750
1116089281_1116089286 23 Left 1116089281 14:40284477-40284499 CCAAACACAAGTGTGATAGGTAG No data
Right 1116089286 14:40284523-40284545 CCCCAACATTTTTGGCATCAGGG 0: 8
1: 178
2: 1219
3: 1749
4: 1395
1116089281_1116089284 22 Left 1116089281 14:40284477-40284499 CCAAACACAAGTGTGATAGGTAG No data
Right 1116089284 14:40284522-40284544 TCCCCAACATTTTTGGCATCAGG 0: 7
1: 173
2: 1253
3: 1748
4: 1463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116089281 Original CRISPR CTACCTATCACACTTGTGTT TGG (reversed) Intergenic
No off target data available for this crispr