ID: 1116089324

View in Genome Browser
Species Human (GRCh38)
Location 14:40284803-40284825
Sequence AATAGGCCATGGATCGGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116089314_1116089324 13 Left 1116089314 14:40284767-40284789 CCTTCCACTCACCTCCTGCTGTG 0: 15
1: 449
2: 799
3: 1214
4: 1484
Right 1116089324 14:40284803-40284825 AATAGGCCATGGATCGGTACCGG No data
1116089319_1116089324 -1 Left 1116089319 14:40284781-40284803 CCTGCTGTGTGGTATGGTTCCTA No data
Right 1116089324 14:40284803-40284825 AATAGGCCATGGATCGGTACCGG No data
1116089318_1116089324 2 Left 1116089318 14:40284778-40284800 CCTCCTGCTGTGTGGTATGGTTC No data
Right 1116089324 14:40284803-40284825 AATAGGCCATGGATCGGTACCGG No data
1116089316_1116089324 9 Left 1116089316 14:40284771-40284793 CCACTCACCTCCTGCTGTGTGGT 0: 16
1: 325
2: 541
3: 833
4: 3029
Right 1116089324 14:40284803-40284825 AATAGGCCATGGATCGGTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116089324 Original CRISPR AATAGGCCATGGATCGGTAC CGG Intergenic
No off target data available for this crispr