ID: 1116097769

View in Genome Browser
Species Human (GRCh38)
Location 14:40393694-40393716
Sequence GAGAGAGTCAATAGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116097769_1116097771 -6 Left 1116097769 14:40393694-40393716 CCTTCCACACTATTGACTCTCTC No data
Right 1116097771 14:40393711-40393733 TCTCTCTCAGTGAACAGCTGTGG No data
1116097769_1116097773 30 Left 1116097769 14:40393694-40393716 CCTTCCACACTATTGACTCTCTC No data
Right 1116097773 14:40393747-40393769 TCCCTATGACCATTTTACTGAGG No data
1116097769_1116097772 3 Left 1116097769 14:40393694-40393716 CCTTCCACACTATTGACTCTCTC No data
Right 1116097772 14:40393720-40393742 GTGAACAGCTGTGGCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116097769 Original CRISPR GAGAGAGTCAATAGTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr