ID: 1116098325

View in Genome Browser
Species Human (GRCh38)
Location 14:40401929-40401951
Sequence GACAGCTAGCACTAAGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116098325_1116098327 13 Left 1116098325 14:40401929-40401951 CCTAGCTCTTAGTGCTAGCTGTC No data
Right 1116098327 14:40401965-40401987 TCTTTCCCCATTGTTTATTGTGG No data
1116098325_1116098328 14 Left 1116098325 14:40401929-40401951 CCTAGCTCTTAGTGCTAGCTGTC No data
Right 1116098328 14:40401966-40401988 CTTTCCCCATTGTTTATTGTGGG No data
1116098325_1116098329 15 Left 1116098325 14:40401929-40401951 CCTAGCTCTTAGTGCTAGCTGTC No data
Right 1116098329 14:40401967-40401989 TTTCCCCATTGTTTATTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116098325 Original CRISPR GACAGCTAGCACTAAGAGCT AGG (reversed) Intergenic
No off target data available for this crispr