ID: 1116101821

View in Genome Browser
Species Human (GRCh38)
Location 14:40447966-40447988
Sequence CTTGATTAAAGCTTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116101821_1116101824 10 Left 1116101821 14:40447966-40447988 CCAGGCATCAAGCTTTAATCAAG No data
Right 1116101824 14:40447999-40448021 GCAGAAGCAGTATAACTGGATGG No data
1116101821_1116101823 6 Left 1116101821 14:40447966-40447988 CCAGGCATCAAGCTTTAATCAAG No data
Right 1116101823 14:40447995-40448017 TTGTGCAGAAGCAGTATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116101821 Original CRISPR CTTGATTAAAGCTTGATGCC TGG (reversed) Intergenic
No off target data available for this crispr