ID: 1116110657

View in Genome Browser
Species Human (GRCh38)
Location 14:40576453-40576475
Sequence TTGTAGGCCCAGAATTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116110654_1116110657 13 Left 1116110654 14:40576417-40576439 CCGGAGCAATCTAGAACAGCTCT No data
Right 1116110657 14:40576453-40576475 TTGTAGGCCCAGAATTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116110657 Original CRISPR TTGTAGGCCCAGAATTACAG TGG Intergenic
No off target data available for this crispr