ID: 1116114876

View in Genome Browser
Species Human (GRCh38)
Location 14:40635389-40635411
Sequence AGAGAGAATGTAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116114868_1116114876 26 Left 1116114868 14:40635340-40635362 CCCTAGCAGTGGTCGTGGGTCAC No data
Right 1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG No data
1116114867_1116114876 27 Left 1116114867 14:40635339-40635361 CCCCTAGCAGTGGTCGTGGGTCA No data
Right 1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG No data
1116114874_1116114876 -7 Left 1116114874 14:40635373-40635395 CCTGTGCATTTTGGGGAGAGAGA No data
Right 1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG No data
1116114869_1116114876 25 Left 1116114869 14:40635341-40635363 CCTAGCAGTGGTCGTGGGTCACG No data
Right 1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116114876 Original CRISPR AGAGAGAATGTAGTGATTGT GGG Intergenic
No off target data available for this crispr