ID: 1116117837

View in Genome Browser
Species Human (GRCh38)
Location 14:40679859-40679881
Sequence TTCAGGAGGTTGTAAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116117832_1116117837 15 Left 1116117832 14:40679821-40679843 CCTTTCCGCAATTTATATTTTCG No data
Right 1116117837 14:40679859-40679881 TTCAGGAGGTTGTAAGTAACTGG No data
1116117833_1116117837 10 Left 1116117833 14:40679826-40679848 CCGCAATTTATATTTTCGTATGC No data
Right 1116117837 14:40679859-40679881 TTCAGGAGGTTGTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116117837 Original CRISPR TTCAGGAGGTTGTAAGTAAC TGG Intergenic
No off target data available for this crispr