ID: 1116118809

View in Genome Browser
Species Human (GRCh38)
Location 14:40694756-40694778
Sequence CGCCAAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116118803_1116118809 13 Left 1116118803 14:40694720-40694742 CCGGAGGGATGGGAGTCAGCGGC 0: 4
1: 34
2: 91
3: 116
4: 216
Right 1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG No data
1116118798_1116118809 24 Left 1116118798 14:40694709-40694731 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG No data
1116118800_1116118809 23 Left 1116118800 14:40694710-40694732 CCTGCTGGATCCGGAGGGATGGG 0: 6
1: 21
2: 86
3: 131
4: 251
Right 1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116118809 Original CRISPR CGCCAAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr