ID: 1116119151

View in Genome Browser
Species Human (GRCh38)
Location 14:40699808-40699830
Sequence GGCTAGGTTTGTTTTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116119151_1116119158 8 Left 1116119151 14:40699808-40699830 CCTCTCCCAAAACAAACCTAGCC No data
Right 1116119158 14:40699839-40699861 GGAGACTAGACTGCCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116119151 Original CRISPR GGCTAGGTTTGTTTTGGGAG AGG (reversed) Intergenic