ID: 1116126610

View in Genome Browser
Species Human (GRCh38)
Location 14:40796602-40796624
Sequence CCCCCTGCTTTGTGCAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116126610_1116126613 -10 Left 1116126610 14:40796602-40796624 CCTTGGCTGCACAAAGCAGGGGG No data
Right 1116126613 14:40796615-40796637 AAGCAGGGGGGATATAGACCTGG No data
1116126610_1116126617 24 Left 1116126610 14:40796602-40796624 CCTTGGCTGCACAAAGCAGGGGG No data
Right 1116126617 14:40796649-40796671 ATTTTCCCCTTCTAGGCCTCTGG No data
1116126610_1116126616 17 Left 1116126610 14:40796602-40796624 CCTTGGCTGCACAAAGCAGGGGG No data
Right 1116126616 14:40796642-40796664 GCAAACAATTTTCCCCTTCTAGG No data
1116126610_1116126618 25 Left 1116126610 14:40796602-40796624 CCTTGGCTGCACAAAGCAGGGGG No data
Right 1116126618 14:40796650-40796672 TTTTCCCCTTCTAGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116126610 Original CRISPR CCCCCTGCTTTGTGCAGCCA AGG (reversed) Intergenic
No off target data available for this crispr