ID: 1116126614

View in Genome Browser
Species Human (GRCh38)
Location 14:40796633-40796655
Sequence GGAAAATTGTTTGCTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116126614_1116126623 8 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126623 14:40796664-40796686 GCCTCTGGGCCTGTGATGGAAGG 0: 51
1: 588
2: 1075
3: 1571
4: 1778
1116126614_1116126622 4 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126622 14:40796660-40796682 CTAGGCCTCTGGGCCTGTGATGG 0: 409
1: 951
2: 1423
3: 1536
4: 1376
1116126614_1116126626 22 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG No data
1116126614_1116126618 -6 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126618 14:40796650-40796672 TTTTCCCCTTCTAGGCCTCTGGG No data
1116126614_1116126617 -7 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126617 14:40796649-40796671 ATTTTCCCCTTCTAGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116126614 Original CRISPR GGAAAATTGTTTGCTGGACC AGG (reversed) Intergenic
No off target data available for this crispr