ID: 1116126618

View in Genome Browser
Species Human (GRCh38)
Location 14:40796650-40796672
Sequence TTTTCCCCTTCTAGGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116126614_1116126618 -6 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126618 14:40796650-40796672 TTTTCCCCTTCTAGGCCTCTGGG No data
1116126610_1116126618 25 Left 1116126610 14:40796602-40796624 CCTTGGCTGCACAAAGCAGGGGG No data
Right 1116126618 14:40796650-40796672 TTTTCCCCTTCTAGGCCTCTGGG No data
1116126608_1116126618 26 Left 1116126608 14:40796601-40796623 CCCTTGGCTGCACAAAGCAGGGG No data
Right 1116126618 14:40796650-40796672 TTTTCCCCTTCTAGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116126618 Original CRISPR TTTTCCCCTTCTAGGCCTCT GGG Intergenic
No off target data available for this crispr