ID: 1116126622

View in Genome Browser
Species Human (GRCh38)
Location 14:40796660-40796682
Sequence CTAGGCCTCTGGGCCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5695
Summary {0: 409, 1: 951, 2: 1423, 3: 1536, 4: 1376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116126615_1116126622 -2 Left 1116126615 14:40796639-40796661 CCAGCAAACAATTTTCCCCTTCT No data
Right 1116126622 14:40796660-40796682 CTAGGCCTCTGGGCCTGTGATGG 0: 409
1: 951
2: 1423
3: 1536
4: 1376
1116126614_1116126622 4 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126622 14:40796660-40796682 CTAGGCCTCTGGGCCTGTGATGG 0: 409
1: 951
2: 1423
3: 1536
4: 1376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116126622 Original CRISPR CTAGGCCTCTGGGCCTGTGA TGG Intergenic
Too many off-targets to display for this crispr