ID: 1116126623

View in Genome Browser
Species Human (GRCh38)
Location 14:40796664-40796686
Sequence GCCTCTGGGCCTGTGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5063
Summary {0: 51, 1: 588, 2: 1075, 3: 1571, 4: 1778}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116126615_1116126623 2 Left 1116126615 14:40796639-40796661 CCAGCAAACAATTTTCCCCTTCT No data
Right 1116126623 14:40796664-40796686 GCCTCTGGGCCTGTGATGGAAGG 0: 51
1: 588
2: 1075
3: 1571
4: 1778
1116126614_1116126623 8 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126623 14:40796664-40796686 GCCTCTGGGCCTGTGATGGAAGG 0: 51
1: 588
2: 1075
3: 1571
4: 1778

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116126623 Original CRISPR GCCTCTGGGCCTGTGATGGA AGG Intergenic
Too many off-targets to display for this crispr