ID: 1116126626

View in Genome Browser
Species Human (GRCh38)
Location 14:40796678-40796700
Sequence GATGGAAGGTGCTGCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116126621_1116126626 -1 Left 1116126621 14:40796656-40796678 CCTTCTAGGCCTCTGGGCCTGTG 0: 42
1: 434
2: 972
3: 1416
4: 1618
Right 1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG No data
1116126620_1116126626 0 Left 1116126620 14:40796655-40796677 CCCTTCTAGGCCTCTGGGCCTGT 0: 12
1: 178
2: 340
3: 567
4: 768
Right 1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG No data
1116126615_1116126626 16 Left 1116126615 14:40796639-40796661 CCAGCAAACAATTTTCCCCTTCT No data
Right 1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG No data
1116126619_1116126626 1 Left 1116126619 14:40796654-40796676 CCCCTTCTAGGCCTCTGGGCCTG No data
Right 1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG No data
1116126624_1116126626 -10 Left 1116126624 14:40796665-40796687 CCTCTGGGCCTGTGATGGAAGGT No data
Right 1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG No data
1116126614_1116126626 22 Left 1116126614 14:40796633-40796655 CCTGGTCCAGCAAACAATTTTCC No data
Right 1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116126626 Original CRISPR GATGGAAGGTGCTGCTGTGA AGG Intergenic
No off target data available for this crispr