ID: 1116127330

View in Genome Browser
Species Human (GRCh38)
Location 14:40804667-40804689
Sequence GTTCACTGAACAATATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116127330_1116127333 -4 Left 1116127330 14:40804667-40804689 CCCTCCAATATTGTTCAGTGAAC No data
Right 1116127333 14:40804686-40804708 GAACAAGCTATATACATCTGTGG No data
1116127330_1116127334 -1 Left 1116127330 14:40804667-40804689 CCCTCCAATATTGTTCAGTGAAC No data
Right 1116127334 14:40804689-40804711 CAAGCTATATACATCTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116127330 Original CRISPR GTTCACTGAACAATATTGGA GGG (reversed) Intergenic
No off target data available for this crispr