ID: 1116133358

View in Genome Browser
Species Human (GRCh38)
Location 14:40889652-40889674
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116133357_1116133358 29 Left 1116133357 14:40889600-40889622 CCATCTGAAAGTATAGCAGGGCT No data
Right 1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116133358 Original CRISPR CTACTGTGCCTGACAAAAAA AGG Intergenic
No off target data available for this crispr