ID: 1116140382

View in Genome Browser
Species Human (GRCh38)
Location 14:40985936-40985958
Sequence AAACCCTGCTTCACAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116140378_1116140382 20 Left 1116140378 14:40985893-40985915 CCAGTCTACTCCACAATCTTGTT No data
Right 1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG No data
1116140380_1116140382 10 Left 1116140380 14:40985903-40985925 CCACAATCTTGTTTTGGTTGCTG No data
Right 1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116140382 Original CRISPR AAACCCTGCTTCACAAAAAT GGG Intergenic