ID: 1116141195

View in Genome Browser
Species Human (GRCh38)
Location 14:40996237-40996259
Sequence CATAAAAATTAGATGAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116141195_1116141196 15 Left 1116141195 14:40996237-40996259 CCACACTTCATCTAATTTTTATG No data
Right 1116141196 14:40996275-40996297 TCCCTCTAAAATGTAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116141195 Original CRISPR CATAAAAATTAGATGAAGTG TGG (reversed) Intergenic
No off target data available for this crispr