ID: 1116146083

View in Genome Browser
Species Human (GRCh38)
Location 14:41070788-41070810
Sequence CTGAATATACAGATAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116146083_1116146084 -2 Left 1116146083 14:41070788-41070810 CCATTTTCTATCTGTATATTCAG No data
Right 1116146084 14:41070809-41070831 AGTTTCTTATCACATAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116146083 Original CRISPR CTGAATATACAGATAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr