ID: 1116147347

View in Genome Browser
Species Human (GRCh38)
Location 14:41091525-41091547
Sequence ATGAATAATAATAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116147347_1116147351 -6 Left 1116147347 14:41091525-41091547 CCTCCCACCTTATTATTATTCAT No data
Right 1116147351 14:41091542-41091564 ATTCATATTTTTTGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116147347 Original CRISPR ATGAATAATAATAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr