ID: 1116147844

View in Genome Browser
Species Human (GRCh38)
Location 14:41098948-41098970
Sequence AAGCCATTTAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6056
Summary {0: 70, 1: 1596, 2: 1945, 3: 1425, 4: 1020}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116147844_1116147850 24 Left 1116147844 14:41098948-41098970 CCTAGAGACTTGTTAAATGGCTT 0: 70
1: 1596
2: 1945
3: 1425
4: 1020
Right 1116147850 14:41098995-41099017 GGGCAATAAAATCCAGGCTGAGG No data
1116147844_1116147848 4 Left 1116147844 14:41098948-41098970 CCTAGAGACTTGTTAAATGGCTT 0: 70
1: 1596
2: 1945
3: 1425
4: 1020
Right 1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG No data
1116147844_1116147849 18 Left 1116147844 14:41098948-41098970 CCTAGAGACTTGTTAAATGGCTT 0: 70
1: 1596
2: 1945
3: 1425
4: 1020
Right 1116147849 14:41098989-41099011 CAATATGGGCAATAAAATCCAGG No data
1116147844_1116147851 27 Left 1116147844 14:41098948-41098970 CCTAGAGACTTGTTAAATGGCTT 0: 70
1: 1596
2: 1945
3: 1425
4: 1020
Right 1116147851 14:41098998-41099020 CAATAAAATCCAGGCTGAGGTGG 0: 88
1: 792
2: 1827
3: 1705
4: 1360
1116147844_1116147847 3 Left 1116147844 14:41098948-41098970 CCTAGAGACTTGTTAAATGGCTT 0: 70
1: 1596
2: 1945
3: 1425
4: 1020
Right 1116147847 14:41098974-41098996 CCAAAATGCTGATAGCAATATGG 0: 84
1: 309
2: 1394
3: 1902
4: 1520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116147844 Original CRISPR AAGCCATTTAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr