ID: 1116147848

View in Genome Browser
Species Human (GRCh38)
Location 14:41098975-41098997
Sequence CAAAATGCTGATAGCAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116147844_1116147848 4 Left 1116147844 14:41098948-41098970 CCTAGAGACTTGTTAAATGGCTT 0: 70
1: 1596
2: 1945
3: 1425
4: 1020
Right 1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116147848 Original CRISPR CAAAATGCTGATAGCAATAT GGG Intergenic
No off target data available for this crispr